mouse single-cell rna sequencing data Search Results


96
Illumina Inc nebnext ultra ii rna library prep kit for illumina

Nebnext Ultra Ii Rna Library Prep Kit For Illumina, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc09808897-398-9-17?v=Illumina+Inc
Average 96 stars, based on 1 article reviews
nebnext ultra ii rna library prep kit for illumina - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

93
fluidigm single cell rna seq

Single Cell Rna Seq, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc11250760-1-3-22?v=fluidigm
Average 93 stars, based on 1 article reviews
single cell rna seq - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
R&D Systems magcellect mouse cd8 t cell isolation kit
Tumor-intrinsic RRBP1 inhibition triggers antitumor immunity. ( A ) Representative images of IHC staining for RRBP1 and <t>CD8</t> + T cells in BC samples. ( B ) The correlation between RRBP1 expression and CD8 + T-cell infiltration was analyzed based on 96 patients from in-house BC cohort. Scale bar: 50 µm. ( C ) Representative images of IHC staining for RRBP1 expression in PD, SD, PR, and CR samples. Scale bar: 50 µm. ( D ) Bar plot showed the response rates of anti-PD-L1 therapy. Blue bars represent CR/PR, Red bars represent PD/SD. ( E ) Volcano plot of RNA-seq data for shNC or shRRBP1 tumors (n=3). Differentially expressed genes were identified with the threshold of |log2 (fold change) | >1 and FDR<0.05. ( F ) GSEA for DEGs showed the activation of immune-associated pathways in shRRBP1 tumors in the RNA-seq data. ( G ) Representative images of IHC and mIHC staining for RRBP1 and CD8 + T cells in shNC, shRRBP1, control or radezolid tumor tissues. Expression levels of the indicated proteins were displayed. Scale bar: 20 µm. ( H, I ) Flow cytometry showed the percentages of CD8 + T cells in CD3 + cells in shNC, shRRBP1, control or radezolid tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using Spearman correlation analysis ( B ), unpaired two-tailed t-test ( I ). ****p<0.0001. BC, bladder cancer; CR, complete response; FDR, false discovery rate; progressive disease; PR, partial response; PD-L1, programmed death-ligand 1; RNA-seq, RNA sequencing; RRB1, ribosomal-binding protein 1; SD, stable disease; IHC, immunohistochemistry; GSEA, gene set enrichment analysis; DEGs, differentially expressed genes; mIHC, multiplex immunohistochemistry.
Magcellect Mouse Cd8 T Cell Isolation Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc12878432-40-32-40?v=R%26D+Systems
Average 94 stars, based on 1 article reviews
magcellect mouse cd8 t cell isolation kit - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

97
OriGene paper n a nrp1 t7e1 forward primer gagggtttatgggggacact
(A) Levels of <t>Nrp1</t> and Nrp2 mRNA expression in freshly isolated Tw2+ cells vs Pax7+ cells, as determined by RNA-seq. (B) Western blot of <t>NRP1</t> <t>protein</t> levels in cultured Tw2-derived myoblasts (Tw2-MB) and Pax7-derived myoblasts (Pax7-MB). GAPDH serves as a loading control. (C) Levels of Nrp1 and Nrp2 mRNA expression in Twist2-overexpressing Tw2-MB (Tw2-DM) and GFP-infected Tw2-MB (GFP-DM) after 4 days in differentiation medium, as determined by RNA-seq. (D) Genome browser shot of Twist2 binding at the Nrp1 promoter in both growth media (GM) and differentiation media (DM). (E) (Top panel) Co-immunostaining of Nrp1 (green), Twist2 (red), and Hoechst (blue) in adult mouse transverse section of quadriceps muscle. (Bottom panel) Zoomed in image of top panel. Scale: 50 µm. See also Figure S1
Paper N A Nrp1 T7e1 Forward Primer Gagggtttatgggggacact, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc06783380-629-70-100?v=OriGene
Average 97 stars, based on 1 article reviews
paper n a nrp1 t7e1 forward primer gagggtttatgggggacact - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

97
Bio X Cell anti murine cd8α
A Confirmation of <t>CD8</t> + depletion by flow cytometry. Gating strategy: Supplementary Fig. . B – K MC38 tumor-bearing mice received 2 Gy 90 Y-, 177 Lu-, or 225 Ac-NM600 + ICI (days −3/0/3) + αCD8 (anti-CD8 on days −5/0/5), RPT + ICI, RPT alone, or αCD8 alone. Effects of CD8 + depletion on tumor growth ( B – H ) and overall survival ( I – K ) are shown. L Flow cytometry treatment scheme. MC38 tumor-bearing mice were randomized to receive either 2 Gy 90 Y-, 177 Lu-, or 225 Ac-NM600 + ICI (days −3/0/3), ICI alone, or untreated control (No Tx). M , N Tumors were harvested on days −3, 4, 8, or 11 and dissociated. The tumor immune infiltrate was analyzed by flow cytometry. Gating strategy: Supplementary Fig. . O Co-culture experiment scheme. Created https://BioRender.com/22ha1p4 . P , Q TNF and IFNγ expression were measured by intracellular flow cytometry staining and analysis of peripheral CD8 + effector memory cells (CD8 + CD44 + CD62L − ) harvested from naïve C57BL/6 mice or treated MC38 tumor-bearing mice following 24 h of co-culture with MC38 or no tumor cells. Gating strategy: Supplementary Fig. . A – H ; M , N ; P , Q Results of one experiment. I – K Results of two independent experiments. A N = 15: depleted; n = 7: <t>IgG2b</t> control. B – H N = 7: 90 Y-, 177 Lu-, 225 Ac-NM600 ± ICI; n = 5: 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI + αCD8, αCD8. I – K N = 17: 90 Y-, 177 Lu-, 225 Ac-NM600 ± ICI; n = 10: αCD8; n = 5: 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI + αCD8. M , N N = 5/treatment group and timepoint except n = 4: 90 Y-NM600 + ICI Day 4; 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI Day 11. P , Q N = 5: naïve, 2 Gy 90 Y-NM600 + ICI; n = 6: ICI, 2 Gy 177 Lu-NM600 + ICI; n = 7: 2 Gy 225 Ac-NM600 + ICI. Unpaired two-tailed t-test was used to compare CD8 + frequency between groups. One-way ANOVA with Tukey’s HSD post hoc test was used to compare flow cytometry results between treatment groups for each marker and timepoint and TNF or IFNγ expression between treatment groups within each co-culture condition. Linear mixed models were used to compare tumor volumes over time between various treatment groups. Statistical testing of the pairwise contrasts was adjusted for multiple comparisons using Tukey’s method. Log-rank test was used to compare survival. Error bars are SEM. O Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p4 .
Anti Murine Cd8α, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc12946300-426-10-17?v=Bio+X+Cell
Average 97 stars, based on 1 article reviews
anti murine cd8α - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

97
Illumina Inc novaseq flow cell
A Confirmation of <t>CD8</t> + depletion by flow cytometry. Gating strategy: Supplementary Fig. . B – K MC38 tumor-bearing mice received 2 Gy 90 Y-, 177 Lu-, or 225 Ac-NM600 + ICI (days −3/0/3) + αCD8 (anti-CD8 on days −5/0/5), RPT + ICI, RPT alone, or αCD8 alone. Effects of CD8 + depletion on tumor growth ( B – H ) and overall survival ( I – K ) are shown. L Flow cytometry treatment scheme. MC38 tumor-bearing mice were randomized to receive either 2 Gy 90 Y-, 177 Lu-, or 225 Ac-NM600 + ICI (days −3/0/3), ICI alone, or untreated control (No Tx). M , N Tumors were harvested on days −3, 4, 8, or 11 and dissociated. The tumor immune infiltrate was analyzed by flow cytometry. Gating strategy: Supplementary Fig. . O Co-culture experiment scheme. Created https://BioRender.com/22ha1p4 . P , Q TNF and IFNγ expression were measured by intracellular flow cytometry staining and analysis of peripheral CD8 + effector memory cells (CD8 + CD44 + CD62L − ) harvested from naïve C57BL/6 mice or treated MC38 tumor-bearing mice following 24 h of co-culture with MC38 or no tumor cells. Gating strategy: Supplementary Fig. . A – H ; M , N ; P , Q Results of one experiment. I – K Results of two independent experiments. A N = 15: depleted; n = 7: <t>IgG2b</t> control. B – H N = 7: 90 Y-, 177 Lu-, 225 Ac-NM600 ± ICI; n = 5: 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI + αCD8, αCD8. I – K N = 17: 90 Y-, 177 Lu-, 225 Ac-NM600 ± ICI; n = 10: αCD8; n = 5: 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI + αCD8. M , N N = 5/treatment group and timepoint except n = 4: 90 Y-NM600 + ICI Day 4; 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI Day 11. P , Q N = 5: naïve, 2 Gy 90 Y-NM600 + ICI; n = 6: ICI, 2 Gy 177 Lu-NM600 + ICI; n = 7: 2 Gy 225 Ac-NM600 + ICI. Unpaired two-tailed t-test was used to compare CD8 + frequency between groups. One-way ANOVA with Tukey’s HSD post hoc test was used to compare flow cytometry results between treatment groups for each marker and timepoint and TNF or IFNγ expression between treatment groups within each co-culture condition. Linear mixed models were used to compare tumor volumes over time between various treatment groups. Statistical testing of the pairwise contrasts was adjusted for multiple comparisons using Tukey’s method. Log-rank test was used to compare survival. Error bars are SEM. O Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p4 .
Novaseq Flow Cell, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/10__1096_slash_fj__202001970r-53-13-12?v=Illumina+Inc
Average 97 stars, based on 1 article reviews
novaseq flow cell - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

99
ATCC 4t1 cells
a Tumor growth of <t>4T1-vector</t> and 4T1-EGFR cells orthotopically implanted into the mammary fat pad ( n = 10/group). Tumor volumes were measured over time; ns, not significant. b Tumor weights at day 10 and day 21 post-implantation; bars represent mean ± SEM. c Lung metastases were analyzed at day 21 by histological analysis of HE-stained lung sections. Quantitative data are shown as mean ± SEM; statistical tests as indicated. d Cytokeratin-positive (CK⁺) tumor cells in inguinal (ILN) lymph nodes were quantified by flow cytometry at indicated time points. Total CK⁺ cell numbers were normalized using counting beads. Statistical analysis was performed using one-way ANOVA. Data are presented as mean ± SEM. e Representative immunofluorescence images showing the distribution of blood vessels (CD31, green) and lymphatic vessels (LYVE1, red) in 4T1-vector (left) and 4T1-EGFR (right) primary tumors. Nuclei are stained with Hoechst (blue). The main panel shows the overall vascular and lymphatic structure in the tumor tissue (scale bar = 1000 µm). Regions of interest (ROIs) from the tumor center (yellow box) and tumor periphery (purple box) are enlarged to show the detailed morphology and localization of blood and lymphatic vessels (scale bar = 200 µm).
4t1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc13057184-243-0-4?v=ATCC
Average 99 stars, based on 1 article reviews
4t1 cells - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
ATCC human melanoma cell line a375
Prediction of ICI outcomes using the FD.sig model with IFN-γ as a key factor. ( A ) Flowchart of constructing FD.model for ICI prediction response. ( B ) The volcano plot of FD.score between tumor and normal tissues in TCGA data; ( C ) Survival analysis of FD.score in TCGA-SKCM. ( D ) ROC curves of eight machine-learning methods in testing set. ( E ) AUCs of eight methods in training and testing sets. ( F ) Comparison of AUCs between FD.sig and other signatures in training and testing sets. ( G ) Comparison of AUCs between FD.sig and other signatures in each cohort. ( H ) The importance ranking of genes in FD.model. ( I ) Comparison of IFNG expression on T cells between responder, non-responder and treatment-naïve in GSE115978 . ( J–K ) Cell viability of <t>A375</t> cells and H1299 cells treated with different concentrations of RSL3/RSL3+Fer-1 for 24 hours after IFN-γ incubation for 0–72 hours (n=3), IFN-γ: 100 mg/mL, Fer-1: 1 µM. ( L–M ) Relative ROS level of A375 ( L ) and H1299 cells ( M ) treated with RSL3/RSL3+Fer-1 for 3 hours after IFN-γ incubation for 48 hours (n=3), IFN-γ: 60 mg/mL, RSL3: 500 nM, Fer-1: 1 µM. AUC, area under the receiver operating characteristic curve; BLCA, bladder urothelial carcinoma; BRCA, breast cancer; CRAD, colorectal adenocarcinoma; FD.model, ferroptosis-based machine learning model; FD.sig, ferroptosis-driver signature; HNSC, head and neck squamous carcinoma; ICI, immune checkpoint inhibitor; IFN, interferon; KICH, kidney chromophobe; KIRC, kidney renal clear cell carcinoma; KIRP, kidney renal papillary cell carcinoma; LIHC, liver hepatocellular carcinoma; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; NR, non-responders; OS, overall survival; PRAD, prostate adenocarcinoma; R, responders; ROC, receiver operating characteristic; ROS, reactive oxygen species; scRNA-seq, single-cell RNA sequencing; SKCM, skin cutaneous melanoma; STAD, stomach adenocarcinoma; TCGA, The Cancer Genome Atlas; THCA, thyroid carcinoma.
Human Melanoma Cell Line A375, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc12983827-43-0-39?v=ATCC
Average 99 stars, based on 1 article reviews
human melanoma cell line a375 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
ATCC yd04 b16 f10 mouse melanoma cells atcc
Prediction of ICI outcomes using the FD.sig model with IFN-γ as a key factor. ( A ) Flowchart of constructing FD.model for ICI prediction response. ( B ) The volcano plot of FD.score between tumor and normal tissues in TCGA data; ( C ) Survival analysis of FD.score in TCGA-SKCM. ( D ) ROC curves of eight machine-learning methods in testing set. ( E ) AUCs of eight methods in training and testing sets. ( F ) Comparison of AUCs between FD.sig and other signatures in training and testing sets. ( G ) Comparison of AUCs between FD.sig and other signatures in each cohort. ( H ) The importance ranking of genes in FD.model. ( I ) Comparison of IFNG expression on T cells between responder, non-responder and treatment-naïve in GSE115978 . ( J–K ) Cell viability of <t>A375</t> cells and H1299 cells treated with different concentrations of RSL3/RSL3+Fer-1 for 24 hours after IFN-γ incubation for 0–72 hours (n=3), IFN-γ: 100 mg/mL, Fer-1: 1 µM. ( L–M ) Relative ROS level of A375 ( L ) and H1299 cells ( M ) treated with RSL3/RSL3+Fer-1 for 3 hours after IFN-γ incubation for 48 hours (n=3), IFN-γ: 60 mg/mL, RSL3: 500 nM, Fer-1: 1 µM. AUC, area under the receiver operating characteristic curve; BLCA, bladder urothelial carcinoma; BRCA, breast cancer; CRAD, colorectal adenocarcinoma; FD.model, ferroptosis-based machine learning model; FD.sig, ferroptosis-driver signature; HNSC, head and neck squamous carcinoma; ICI, immune checkpoint inhibitor; IFN, interferon; KICH, kidney chromophobe; KIRC, kidney renal clear cell carcinoma; KIRP, kidney renal papillary cell carcinoma; LIHC, liver hepatocellular carcinoma; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; NR, non-responders; OS, overall survival; PRAD, prostate adenocarcinoma; R, responders; ROC, receiver operating characteristic; ROS, reactive oxygen species; scRNA-seq, single-cell RNA sequencing; SKCM, skin cutaneous melanoma; STAD, stomach adenocarcinoma; TCGA, The Cancer Genome Atlas; THCA, thyroid carcinoma.
Yd04 B16 F10 Mouse Melanoma Cells Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pm41895288-259-181-186?v=ATCC
Average 99 stars, based on 1 article reviews
yd04 b16 f10 mouse melanoma cells atcc - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

95
ATCC murine prostate cancer myc cap cell line
A – <t>C</t> <t>Myc-CaP</t> tumor-bearing mice received the indicated treatment. A Experimental scheme. Tumor growth ( B ) and overall survival ( C ) are shown. D – H Single cell RNA sequencing of B78 tumors. D Cell type fractions in lymphoid compartment. Cell types having >5% fraction in at least one sample are represented. E Single cell RNA sequencing treatment scheme. B78 tumor-bearing mice received either 2 Gy 90 Y-, 177 Lu-, 225 Ac-NM600 or EBRT + ICI (anti-CTLA4 and anti-PD-L1) on days −3/0/3 or ICI alone. Tumors were harvested on day 15, dissociated, and immune cells were isolated by Ficoll density gradient centrifugation for single cell RNA sequencing analysis. Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p . F UMAP of single cell RNA sequencing data colored by samples. Each panel shows identical cell population with one sample in color and all the others in gray. Regions containing T cells, myeloid cells, B cells, and epithelial cells/fibroblasts are indicated. G Representative B78 tumor photomicrographs for B cell marker CD20 at day 15 following 2 Gy 90 Y-, 177 Lu-, 225 Ac-NM600 or 2 Gy EBRT + ICI or ICI alone; brown = positive immunolabeling. H Quantification of CD20 + cell clusters/tumor. Cell cluster: ≥5 cells. Scale bar = 200 μm. B – H Results of one experiment. B , C n = 10/treatment group. D – F 3 mice/treatment group pooled into one sample/treatment group for single cell RNA sequencing analysis. Numbers of cells analyzed provided in Supplementary Table . 90 Y-NM600 + ICI, n = 6067; 177 Lu-NM600 + ICI, n = 9808; 225 Ac-NM600 + ICI, n = 6503; EBRT + ICI, n = 7045; ICI, n = 11,249. D – F n = 3 tumors/treatment group. G Representative image/treatment group from ( H ). H n = 4 tumors: 177 Lu-NM600 + ICI; n = 3 tumors: 90 Y-NM600 + ICI, 225 Ac-NM600 + ICI, EBRT + ICI, ICI. Linear mixed models were used to compare tumor volumes over time between various treatment groups. Statistical testing of the pairwise contrasts was adjusted for multiple comparisons using Tukey’s method. Log-rank test was used to compare survival. One-way ANOVA with Tukey’s HSD post hoc test was used to compare CD20 IHC quantification between treatment groups. Error bars are SEM. E Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p4 .
Murine Prostate Cancer Myc Cap Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc12946300-401-23-38?v=ATCC
Average 95 stars, based on 1 article reviews
murine prostate cancer myc cap cell line - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

96
Broad Clinical Labs cell rna seq dataset
(A–E) The mRNA transcripts of four types of coronavirus receptors such as membrane alanyl aminopeptidase (ANPEP, CD13, receptor for human coronavirus-229E), carcinoembryonic antigen family cell adhesion molecule 1 (CEACAM1, receptor for mouse hepatitis virus), angiotensin-converting enzyme 2 (ACE, receptor for SARS-CoV, SARS-CoV2), and dipeptidyl peptidase-4 (DPP4, receptor for MERS-CoV) as well as TMPRSS2 are found in two clusters of human heart endothelial cells. The data mining analyses were performed on the <t>Single</t> <t>Cell</t> <t>RNA-Seq</t> database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP498/transcriptional-and-cellular-diversity-of-the-human-heart#study-summary ). (F–J) The mRNA transcripts of four types of coronavirus receptors such as ANPEP, CEACAM1, ACE, and DPP4 are found in mouse aortic endothelial cell clusters. The data mining analyses were performed on the Single Cell RNA-Seq database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP289/single-cell-analysis-of-the-normal-mouse-aorta-reveals-functionally-distinct-endothelial-cell-populations#study-summay , PMID: 31146585). (F) ANPEP expressions in three endothelial cell clusters were circled in red in the Scatter; (G) ANPEP expressions in three endothelial cell clusters were boxed in red in the Distribution; (H) CEACAM1 expressions in three endothelial cell clusters were also boxed in read in the Distribution; (I) ACE expressions in three endothelial cell clusters were also boxed in read in the Distribution; (J) DPP4 expressions in three endothelial cell clusters were also boxed in read in the Distribution. (K) A new working model: Infection of vascular endothelial cells by SARS-CoV2/MERS-CoV causes innate immune responses in endothelial cells, which may induces cytokine storm, and triggers thromboembolism. The part of figure was created with BioRender.com .
Cell Rna Seq Dataset, supplied by Broad Clinical Labs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc08269631-389-25-42?v=Broad+Clinical+Labs
Average 96 stars, based on 1 article reviews
cell rna seq dataset - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Zymo Research zr rna microprep kit
(A–E) The mRNA transcripts of four types of coronavirus receptors such as membrane alanyl aminopeptidase (ANPEP, CD13, receptor for human coronavirus-229E), carcinoembryonic antigen family cell adhesion molecule 1 (CEACAM1, receptor for mouse hepatitis virus), angiotensin-converting enzyme 2 (ACE, receptor for SARS-CoV, SARS-CoV2), and dipeptidyl peptidase-4 (DPP4, receptor for MERS-CoV) as well as TMPRSS2 are found in two clusters of human heart endothelial cells. The data mining analyses were performed on the <t>Single</t> <t>Cell</t> <t>RNA-Seq</t> database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP498/transcriptional-and-cellular-diversity-of-the-human-heart#study-summary ). (F–J) The mRNA transcripts of four types of coronavirus receptors such as ANPEP, CEACAM1, ACE, and DPP4 are found in mouse aortic endothelial cell clusters. The data mining analyses were performed on the Single Cell RNA-Seq database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP289/single-cell-analysis-of-the-normal-mouse-aorta-reveals-functionally-distinct-endothelial-cell-populations#study-summay , PMID: 31146585). (F) ANPEP expressions in three endothelial cell clusters were circled in red in the Scatter; (G) ANPEP expressions in three endothelial cell clusters were boxed in red in the Distribution; (H) CEACAM1 expressions in three endothelial cell clusters were also boxed in read in the Distribution; (I) ACE expressions in three endothelial cell clusters were also boxed in read in the Distribution; (J) DPP4 expressions in three endothelial cell clusters were also boxed in read in the Distribution. (K) A new working model: Infection of vascular endothelial cells by SARS-CoV2/MERS-CoV causes innate immune responses in endothelial cells, which may induces cytokine storm, and triggers thromboembolism. The part of figure was created with BioRender.com .
Zr Rna Microprep Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+single-cell+rna+sequencing+data/pmc03548402-104-10-14?v=Zymo+Research
Average 96 stars, based on 1 article reviews
zr rna microprep kit - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results


Journal: Cell reports

Article Title: ΔNp63 drives dysplastic alveolar remodeling and restricts epithelial plasticity upon severe lung injury

doi: 10.1016/j.celrep.2022.111805

Figure Lengend Snippet:

Article Snippet: PolyA-selected RNA was used to generate libraries using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions.

Techniques: Virus, Recombinant, Lysis, Magnetic Beads, Migration, Single-cell Transcriptomics, Software

Tumor-intrinsic RRBP1 inhibition triggers antitumor immunity. ( A ) Representative images of IHC staining for RRBP1 and CD8 + T cells in BC samples. ( B ) The correlation between RRBP1 expression and CD8 + T-cell infiltration was analyzed based on 96 patients from in-house BC cohort. Scale bar: 50 µm. ( C ) Representative images of IHC staining for RRBP1 expression in PD, SD, PR, and CR samples. Scale bar: 50 µm. ( D ) Bar plot showed the response rates of anti-PD-L1 therapy. Blue bars represent CR/PR, Red bars represent PD/SD. ( E ) Volcano plot of RNA-seq data for shNC or shRRBP1 tumors (n=3). Differentially expressed genes were identified with the threshold of |log2 (fold change) | >1 and FDR<0.05. ( F ) GSEA for DEGs showed the activation of immune-associated pathways in shRRBP1 tumors in the RNA-seq data. ( G ) Representative images of IHC and mIHC staining for RRBP1 and CD8 + T cells in shNC, shRRBP1, control or radezolid tumor tissues. Expression levels of the indicated proteins were displayed. Scale bar: 20 µm. ( H, I ) Flow cytometry showed the percentages of CD8 + T cells in CD3 + cells in shNC, shRRBP1, control or radezolid tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using Spearman correlation analysis ( B ), unpaired two-tailed t-test ( I ). ****p<0.0001. BC, bladder cancer; CR, complete response; FDR, false discovery rate; progressive disease; PR, partial response; PD-L1, programmed death-ligand 1; RNA-seq, RNA sequencing; RRB1, ribosomal-binding protein 1; SD, stable disease; IHC, immunohistochemistry; GSEA, gene set enrichment analysis; DEGs, differentially expressed genes; mIHC, multiplex immunohistochemistry.

Journal: Journal for Immunotherapy of Cancer

Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer

doi: 10.1136/jitc-2025-013809

Figure Lengend Snippet: Tumor-intrinsic RRBP1 inhibition triggers antitumor immunity. ( A ) Representative images of IHC staining for RRBP1 and CD8 + T cells in BC samples. ( B ) The correlation between RRBP1 expression and CD8 + T-cell infiltration was analyzed based on 96 patients from in-house BC cohort. Scale bar: 50 µm. ( C ) Representative images of IHC staining for RRBP1 expression in PD, SD, PR, and CR samples. Scale bar: 50 µm. ( D ) Bar plot showed the response rates of anti-PD-L1 therapy. Blue bars represent CR/PR, Red bars represent PD/SD. ( E ) Volcano plot of RNA-seq data for shNC or shRRBP1 tumors (n=3). Differentially expressed genes were identified with the threshold of |log2 (fold change) | >1 and FDR<0.05. ( F ) GSEA for DEGs showed the activation of immune-associated pathways in shRRBP1 tumors in the RNA-seq data. ( G ) Representative images of IHC and mIHC staining for RRBP1 and CD8 + T cells in shNC, shRRBP1, control or radezolid tumor tissues. Expression levels of the indicated proteins were displayed. Scale bar: 20 µm. ( H, I ) Flow cytometry showed the percentages of CD8 + T cells in CD3 + cells in shNC, shRRBP1, control or radezolid tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using Spearman correlation analysis ( B ), unpaired two-tailed t-test ( I ). ****p<0.0001. BC, bladder cancer; CR, complete response; FDR, false discovery rate; progressive disease; PR, partial response; PD-L1, programmed death-ligand 1; RNA-seq, RNA sequencing; RRB1, ribosomal-binding protein 1; SD, stable disease; IHC, immunohistochemistry; GSEA, gene set enrichment analysis; DEGs, differentially expressed genes; mIHC, multiplex immunohistochemistry.

Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the MagCellect Mouse CD8 + T Cell Isolation Kit (R&D Systems) according to the manufacturer’s protocols.

Techniques: Inhibition, Immunohistochemistry, Expressing, RNA Sequencing, Activation Assay, Staining, Control, Flow Cytometry, Two Tailed Test, Binding Assay, Multiplex Assay

Single-cell RNA sequencing reveals the difference of CD8 + T-cell subgroup. The UMAP plot of CD8 + T cells subpopulation, color-coded by cell cluster and cell type. ( A ) The expression of markers in each CD8 + T cells subpopulation. ( B ) Bar plot showed the proportion of CD8 + T cells subpopulation in the shNC and shRRBP1 groups. ( C ) The percentage of each CD8 + T-cell clusters in shNC and shRRBP1 groups. ( D ) Heatmap showed the differentially activated pathway among all the CD8 + T-cell clusters. ( E ) The differentially expressed genes in CD8 + T cells between shNC and shRRBP1 groups. ( F ) KEGG analysis for differentially expressed genes showed the enrichment of immune-associated pathways. ( G, H ) mIHC and flow cytometric analysis displayed the tumor-infiltrating IFN-γ + or GZMB + CD8 + T cells in shNC or shRRBP1 tumor tissues. Scale bar: 20 µm. ( I–K ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Isotype control (IgG) or anti-mouse CD8 antibody administered on days –6, –3, and –1 before tumor challenge, with the same dose repeated on days 7, 9 and 11 after tumor challenge. Tumor sizes ( I ), volumes ( J ), and weight ( K ) were measured. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( H, K ) and two-way ANOVA with Tukey’s multiple comparison test ( J ). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. ANOVA, analysis of variance; GZMB, Granzyme B; IFN, interferon; TEX, exhausted T cells; UMAP, Uniform Manifold Approximation and Projection; mIHC, multiplex immunohistochemistry; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Journal: Journal for Immunotherapy of Cancer

Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer

doi: 10.1136/jitc-2025-013809

Figure Lengend Snippet: Single-cell RNA sequencing reveals the difference of CD8 + T-cell subgroup. The UMAP plot of CD8 + T cells subpopulation, color-coded by cell cluster and cell type. ( A ) The expression of markers in each CD8 + T cells subpopulation. ( B ) Bar plot showed the proportion of CD8 + T cells subpopulation in the shNC and shRRBP1 groups. ( C ) The percentage of each CD8 + T-cell clusters in shNC and shRRBP1 groups. ( D ) Heatmap showed the differentially activated pathway among all the CD8 + T-cell clusters. ( E ) The differentially expressed genes in CD8 + T cells between shNC and shRRBP1 groups. ( F ) KEGG analysis for differentially expressed genes showed the enrichment of immune-associated pathways. ( G, H ) mIHC and flow cytometric analysis displayed the tumor-infiltrating IFN-γ + or GZMB + CD8 + T cells in shNC or shRRBP1 tumor tissues. Scale bar: 20 µm. ( I–K ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Isotype control (IgG) or anti-mouse CD8 antibody administered on days –6, –3, and –1 before tumor challenge, with the same dose repeated on days 7, 9 and 11 after tumor challenge. Tumor sizes ( I ), volumes ( J ), and weight ( K ) were measured. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( H, K ) and two-way ANOVA with Tukey’s multiple comparison test ( J ). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. ANOVA, analysis of variance; GZMB, Granzyme B; IFN, interferon; TEX, exhausted T cells; UMAP, Uniform Manifold Approximation and Projection; mIHC, multiplex immunohistochemistry; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the MagCellect Mouse CD8 + T Cell Isolation Kit (R&D Systems) according to the manufacturer’s protocols.

Techniques: Single Cell, RNA Sequencing, Expressing, Injection, Control, Two Tailed Test, Comparison, Multiplex Assay, Immunohistochemistry

RRBP1 inhibition promotes antitumor immunity via the CXCL10-CXCR3 axis in BC. ( A ) ScRNA-seq data showed the CXCR3 expression of CD8+T cells in shNC and shRRBP1 groups. ( B ) The correlation between CXCR3 expression and CXCL10 expression or activated CD8 + T cell based on 571 patients from TCGA-BLCA cohort and GSE13507 cohorts. ( C ) MB49 cells were co-cultured with CD8 + T cells, and tumor cells were stained with crystal violet. ( D ) Evaluation of the effect of genetic inhibition of RRBP1 on the cytotoxicity of CD8 + T cells in vitro conditioned culture model. ( E ) Schematic diagram of in vitro CD8 + T-cell migration assays. ( F ) The number of CD8 + T cells passing through the membrane of a Transwell system was analyzed by flow cytometry. ( G–I ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Tumor-bearing mice received intraperitoneal injection of either vehicle or anti-CXCL10 when the tumor volume reached a calculated average of 100 mm 3 . The tumor sizes ( G ), volumes ( H ), and weights ( I ) were measured. ( J ) Representative images of IHC and mIHC staining for CD8, CXCR3, CXCL10, IFN-γ, GZMB in different tumor tissues. ( K ) Flow cytometric analysis of tumor-infiltrating CD8 + T cells, CXCR3 + CD8 + T cells, IFN-γ + CD8 + T cells or GZMB + CD8 + T cells in distinct tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( D, F, I, K ) and two-way ANOVA with Tukey’s multiple comparison test ( H ). The data presented represent on one or three independent experiments. *p<0.01, **p<0.01, ***p<0.001. ANOVA, analysis of variance; BC, bladder cancer; GZMB, Granzyme B; IFN, interferon; RRBP1, ribosomal-binding protein 1; scRNA-seq, single-cell RNA sequencing; IHC, immunohistochemistry; mIHC, multiplex immunohistochemistry; BLCA, bladder urothelial carcinoma.

Journal: Journal for Immunotherapy of Cancer

Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer

doi: 10.1136/jitc-2025-013809

Figure Lengend Snippet: RRBP1 inhibition promotes antitumor immunity via the CXCL10-CXCR3 axis in BC. ( A ) ScRNA-seq data showed the CXCR3 expression of CD8+T cells in shNC and shRRBP1 groups. ( B ) The correlation between CXCR3 expression and CXCL10 expression or activated CD8 + T cell based on 571 patients from TCGA-BLCA cohort and GSE13507 cohorts. ( C ) MB49 cells were co-cultured with CD8 + T cells, and tumor cells were stained with crystal violet. ( D ) Evaluation of the effect of genetic inhibition of RRBP1 on the cytotoxicity of CD8 + T cells in vitro conditioned culture model. ( E ) Schematic diagram of in vitro CD8 + T-cell migration assays. ( F ) The number of CD8 + T cells passing through the membrane of a Transwell system was analyzed by flow cytometry. ( G–I ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Tumor-bearing mice received intraperitoneal injection of either vehicle or anti-CXCL10 when the tumor volume reached a calculated average of 100 mm 3 . The tumor sizes ( G ), volumes ( H ), and weights ( I ) were measured. ( J ) Representative images of IHC and mIHC staining for CD8, CXCR3, CXCL10, IFN-γ, GZMB in different tumor tissues. ( K ) Flow cytometric analysis of tumor-infiltrating CD8 + T cells, CXCR3 + CD8 + T cells, IFN-γ + CD8 + T cells or GZMB + CD8 + T cells in distinct tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( D, F, I, K ) and two-way ANOVA with Tukey’s multiple comparison test ( H ). The data presented represent on one or three independent experiments. *p<0.01, **p<0.01, ***p<0.001. ANOVA, analysis of variance; BC, bladder cancer; GZMB, Granzyme B; IFN, interferon; RRBP1, ribosomal-binding protein 1; scRNA-seq, single-cell RNA sequencing; IHC, immunohistochemistry; mIHC, multiplex immunohistochemistry; BLCA, bladder urothelial carcinoma.

Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the MagCellect Mouse CD8 + T Cell Isolation Kit (R&D Systems) according to the manufacturer’s protocols.

Techniques: Inhibition, Expressing, Cell Culture, Staining, In Vitro, Migration, Membrane, Flow Cytometry, Injection, Two Tailed Test, Comparison, Binding Assay, Single Cell, RNA Sequencing, Immunohistochemistry, Multiplex Assay

RRBP1 inhibition enhances response to anti-PD-L1 therapy in BC. ( A–D ) The protein expression of surface PD-L1 was analyzed in BC cells or tumor tissues by flow cytometry after RRBP1 inhibition and was shown as the mean fluorescence intensity. ( E–G ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Tumor-bearing mice were received intraperitoneal injection of either vehicle or anti-PD-L1 antibody when the tumor volume reached a calculated average of 100 mm 3 . The tumor sizes ( E ), volumes ( F ), and weights ( G ) were measured. ( H ) Representative images of IHC and mIHC staining for CD8, CXCR3, CXCL10, IFN-γ, GZMB in different tumor tissues. ( I ) Flow cytometric analysis of tumor-infiltrating CD8 + T cells, CXCR3 + CD8 + T cells, IFN-γ + CD8 + T cells or GZMB + CD8 + T cells in distinct tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( B, D, G, I ) and two-way ANOVA with Tukey’s multiple comparison test ( F ). The data presented represent on one or three independent experiments. *p<0.01, **p<0.01, ***p<0.001. ANOVA, analysis of variance; BC, bladder cancer; GZMB, Granzyme B; IFN, interferon; PD-L1, programmed death-ligand 1; RRBP1, ribosomal-binding protein 1; IHC, immunohistochemistry; mIHC, multiplex immunohistochemistry.

Journal: Journal for Immunotherapy of Cancer

Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer

doi: 10.1136/jitc-2025-013809

Figure Lengend Snippet: RRBP1 inhibition enhances response to anti-PD-L1 therapy in BC. ( A–D ) The protein expression of surface PD-L1 was analyzed in BC cells or tumor tissues by flow cytometry after RRBP1 inhibition and was shown as the mean fluorescence intensity. ( E–G ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Tumor-bearing mice were received intraperitoneal injection of either vehicle or anti-PD-L1 antibody when the tumor volume reached a calculated average of 100 mm 3 . The tumor sizes ( E ), volumes ( F ), and weights ( G ) were measured. ( H ) Representative images of IHC and mIHC staining for CD8, CXCR3, CXCL10, IFN-γ, GZMB in different tumor tissues. ( I ) Flow cytometric analysis of tumor-infiltrating CD8 + T cells, CXCR3 + CD8 + T cells, IFN-γ + CD8 + T cells or GZMB + CD8 + T cells in distinct tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( B, D, G, I ) and two-way ANOVA with Tukey’s multiple comparison test ( F ). The data presented represent on one or three independent experiments. *p<0.01, **p<0.01, ***p<0.001. ANOVA, analysis of variance; BC, bladder cancer; GZMB, Granzyme B; IFN, interferon; PD-L1, programmed death-ligand 1; RRBP1, ribosomal-binding protein 1; IHC, immunohistochemistry; mIHC, multiplex immunohistochemistry.

Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the MagCellect Mouse CD8 + T Cell Isolation Kit (R&D Systems) according to the manufacturer’s protocols.

Techniques: Inhibition, Expressing, Flow Cytometry, Fluorescence, Injection, Staining, Two Tailed Test, Comparison, Binding Assay, Immunohistochemistry, Multiplex Assay

(A) Levels of Nrp1 and Nrp2 mRNA expression in freshly isolated Tw2+ cells vs Pax7+ cells, as determined by RNA-seq. (B) Western blot of NRP1 protein levels in cultured Tw2-derived myoblasts (Tw2-MB) and Pax7-derived myoblasts (Pax7-MB). GAPDH serves as a loading control. (C) Levels of Nrp1 and Nrp2 mRNA expression in Twist2-overexpressing Tw2-MB (Tw2-DM) and GFP-infected Tw2-MB (GFP-DM) after 4 days in differentiation medium, as determined by RNA-seq. (D) Genome browser shot of Twist2 binding at the Nrp1 promoter in both growth media (GM) and differentiation media (DM). (E) (Top panel) Co-immunostaining of Nrp1 (green), Twist2 (red), and Hoechst (blue) in adult mouse transverse section of quadriceps muscle. (Bottom panel) Zoomed in image of top panel. Scale: 50 µm. See also Figure S1

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Levels of Nrp1 and Nrp2 mRNA expression in freshly isolated Tw2+ cells vs Pax7+ cells, as determined by RNA-seq. (B) Western blot of NRP1 protein levels in cultured Tw2-derived myoblasts (Tw2-MB) and Pax7-derived myoblasts (Pax7-MB). GAPDH serves as a loading control. (C) Levels of Nrp1 and Nrp2 mRNA expression in Twist2-overexpressing Tw2-MB (Tw2-DM) and GFP-infected Tw2-MB (GFP-DM) after 4 days in differentiation medium, as determined by RNA-seq. (D) Genome browser shot of Twist2 binding at the Nrp1 promoter in both growth media (GM) and differentiation media (DM). (E) (Top panel) Co-immunostaining of Nrp1 (green), Twist2 (red), and Hoechst (blue) in adult mouse transverse section of quadriceps muscle. (Bottom panel) Zoomed in image of top panel. Scale: 50 µm. See also Figure S1

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Expressing, Isolation, RNA Sequencing Assay, Western Blot, Cell Culture, Derivative Assay, Infection, Binding Assay, Immunostaining

(A) Overexpression of Nrp1 increases repulsion of Tw2-MB from Sema3a stripes. (Top) Control Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. (Bottom) Nrp1-overexpressing Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. (C) Overexpression of Nrp1 resulted in repulsion of Pax7-MB from Sema3a stripes. (Top) Control-infected Pax7-MB (red) were seeded on Sema3a stripes (green) and analyzed 1 day after seeding. (Bottom) Nrp1-overexpresssing Pax7-MB (red) were seeded on Sema3a stripes (green). Cells were analyzed 1 day after seeding and co-stained with Hoechst (blue). Scale bar: 100 µm. (D) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4C. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. **: p <0.005. See also Figure S4. Source data for 4B and 4C are provided in Supplementary Table 1.

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Overexpression of Nrp1 increases repulsion of Tw2-MB from Sema3a stripes. (Top) Control Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. (Bottom) Nrp1-overexpressing Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. (C) Overexpression of Nrp1 resulted in repulsion of Pax7-MB from Sema3a stripes. (Top) Control-infected Pax7-MB (red) were seeded on Sema3a stripes (green) and analyzed 1 day after seeding. (Bottom) Nrp1-overexpresssing Pax7-MB (red) were seeded on Sema3a stripes (green). Cells were analyzed 1 day after seeding and co-stained with Hoechst (blue). Scale bar: 100 µm. (D) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4C. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. **: p <0.005. See also Figure S4. Source data for 4B and 4C are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Over Expression, Staining, Infection

(A) Knockdown of Nrp1 by shRNA in Tw2-MB (red) abolished Sema3a avoidance. (Top) Control shRNA (shCtrl) infected Tw2-MB 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Tw2-MB overexpressing either shNrp1–1 or shNrp1–2 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. ***: p < 0.0005, ****: p < 0.00005. (C) Western blot showing loss of NRP1 protein in Tw2-MB infected with sgRNAs targeting Nrp1. GAPDH was used as a loading control. (D) (Top) Control pLentiCrisprV2-infected Tw2-MB (red) 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Two separate Nrp1 sgRNA-infected Tw2-MB (sgNrp1–2 and sgNrp1–5) 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (E) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5D. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. See also Figure S5. Source data for 5B and E are provided in Supplementary Table 1.

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Knockdown of Nrp1 by shRNA in Tw2-MB (red) abolished Sema3a avoidance. (Top) Control shRNA (shCtrl) infected Tw2-MB 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Tw2-MB overexpressing either shNrp1–1 or shNrp1–2 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. ***: p < 0.0005, ****: p < 0.00005. (C) Western blot showing loss of NRP1 protein in Tw2-MB infected with sgRNAs targeting Nrp1. GAPDH was used as a loading control. (D) (Top) Control pLentiCrisprV2-infected Tw2-MB (red) 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Two separate Nrp1 sgRNA-infected Tw2-MB (sgNrp1–2 and sgNrp1–5) 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (E) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5D. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. See also Figure S5. Source data for 5B and E are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: shRNA, Infection, Staining, Western Blot

(A) Experimental scheme for chimeric fusion assay. Tw2-MB were infected with retroviruses expressing shNrp1–2, control empty vector, or Nrp1, and mixed with primary myoblasts (SCs) infected with retroviruses expressing Sema3a-EGFP in equal numbers. Cells were then differentiated for 7 days. (B) SCs over-expressing Sema3a (green) were mixed with Tw2-MB (tdTO+) infected with Nrp1 (top), control empty vector (middle), or shNrp1–2 (bottom) retroviruses and differentiated for 7 days. Cells were fixed and stained with Hoechst (blue) and an antibody against fast myosin (MY32; white). Arrow indicates chimeric myotubes that are both Sema3a+ and tdTO+; * represents myotubes that Sema3a+ only; and arrowhead represents myotubes that are tdTO+ only. Scale bar: 50 µm. (C) Quantification of percent of nuclei in chimeric fibers for Figure 6B. Percent of nuclei in chimeric fibers was calculated as the percent of the number of nuclei in chimeric fibers over the total number of nuclei (red-only, green-only, and chimeric myofibers). Three fields per sample per experiment were quantified. Three separate experiments were performed. *: p < 0.05, **: p < 0.005. See also Figure S6. Source data for 6C is provided in Supplementary Table 1.

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Experimental scheme for chimeric fusion assay. Tw2-MB were infected with retroviruses expressing shNrp1–2, control empty vector, or Nrp1, and mixed with primary myoblasts (SCs) infected with retroviruses expressing Sema3a-EGFP in equal numbers. Cells were then differentiated for 7 days. (B) SCs over-expressing Sema3a (green) were mixed with Tw2-MB (tdTO+) infected with Nrp1 (top), control empty vector (middle), or shNrp1–2 (bottom) retroviruses and differentiated for 7 days. Cells were fixed and stained with Hoechst (blue) and an antibody against fast myosin (MY32; white). Arrow indicates chimeric myotubes that are both Sema3a+ and tdTO+; * represents myotubes that Sema3a+ only; and arrowhead represents myotubes that are tdTO+ only. Scale bar: 50 µm. (C) Quantification of percent of nuclei in chimeric fibers for Figure 6B. Percent of nuclei in chimeric fibers was calculated as the percent of the number of nuclei in chimeric fibers over the total number of nuclei (red-only, green-only, and chimeric myofibers). Three fields per sample per experiment were quantified. Three separate experiments were performed. *: p < 0.05, **: p < 0.005. See also Figure S6. Source data for 6C is provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Single Vesicle Fusion Assay, Infection, Expressing, Plasmid Preparation, Staining

KEY RESOURCE TABLE

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: KEY RESOURCE TABLE

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Recombinant, Isolation, Transgenic Assay, Software

A Confirmation of CD8 + depletion by flow cytometry. Gating strategy: Supplementary Fig. . B – K MC38 tumor-bearing mice received 2 Gy 90 Y-, 177 Lu-, or 225 Ac-NM600 + ICI (days −3/0/3) + αCD8 (anti-CD8 on days −5/0/5), RPT + ICI, RPT alone, or αCD8 alone. Effects of CD8 + depletion on tumor growth ( B – H ) and overall survival ( I – K ) are shown. L Flow cytometry treatment scheme. MC38 tumor-bearing mice were randomized to receive either 2 Gy 90 Y-, 177 Lu-, or 225 Ac-NM600 + ICI (days −3/0/3), ICI alone, or untreated control (No Tx). M , N Tumors were harvested on days −3, 4, 8, or 11 and dissociated. The tumor immune infiltrate was analyzed by flow cytometry. Gating strategy: Supplementary Fig. . O Co-culture experiment scheme. Created https://BioRender.com/22ha1p4 . P , Q TNF and IFNγ expression were measured by intracellular flow cytometry staining and analysis of peripheral CD8 + effector memory cells (CD8 + CD44 + CD62L − ) harvested from naïve C57BL/6 mice or treated MC38 tumor-bearing mice following 24 h of co-culture with MC38 or no tumor cells. Gating strategy: Supplementary Fig. . A – H ; M , N ; P , Q Results of one experiment. I – K Results of two independent experiments. A N = 15: depleted; n = 7: IgG2b control. B – H N = 7: 90 Y-, 177 Lu-, 225 Ac-NM600 ± ICI; n = 5: 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI + αCD8, αCD8. I – K N = 17: 90 Y-, 177 Lu-, 225 Ac-NM600 ± ICI; n = 10: αCD8; n = 5: 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI + αCD8. M , N N = 5/treatment group and timepoint except n = 4: 90 Y-NM600 + ICI Day 4; 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI Day 11. P , Q N = 5: naïve, 2 Gy 90 Y-NM600 + ICI; n = 6: ICI, 2 Gy 177 Lu-NM600 + ICI; n = 7: 2 Gy 225 Ac-NM600 + ICI. Unpaired two-tailed t-test was used to compare CD8 + frequency between groups. One-way ANOVA with Tukey’s HSD post hoc test was used to compare flow cytometry results between treatment groups for each marker and timepoint and TNF or IFNγ expression between treatment groups within each co-culture condition. Linear mixed models were used to compare tumor volumes over time between various treatment groups. Statistical testing of the pairwise contrasts was adjusted for multiple comparisons using Tukey’s method. Log-rank test was used to compare survival. Error bars are SEM. O Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p4 .

Journal: Nature Communications

Article Title: Priming versus propagating: distinct immune effects of alpha- versus beta-particle emitting radiopharmaceuticals when combined with immune checkpoint inhibition in mice

doi: 10.1038/s41467-026-68834-1

Figure Lengend Snippet: A Confirmation of CD8 + depletion by flow cytometry. Gating strategy: Supplementary Fig. . B – K MC38 tumor-bearing mice received 2 Gy 90 Y-, 177 Lu-, or 225 Ac-NM600 + ICI (days −3/0/3) + αCD8 (anti-CD8 on days −5/0/5), RPT + ICI, RPT alone, or αCD8 alone. Effects of CD8 + depletion on tumor growth ( B – H ) and overall survival ( I – K ) are shown. L Flow cytometry treatment scheme. MC38 tumor-bearing mice were randomized to receive either 2 Gy 90 Y-, 177 Lu-, or 225 Ac-NM600 + ICI (days −3/0/3), ICI alone, or untreated control (No Tx). M , N Tumors were harvested on days −3, 4, 8, or 11 and dissociated. The tumor immune infiltrate was analyzed by flow cytometry. Gating strategy: Supplementary Fig. . O Co-culture experiment scheme. Created https://BioRender.com/22ha1p4 . P , Q TNF and IFNγ expression were measured by intracellular flow cytometry staining and analysis of peripheral CD8 + effector memory cells (CD8 + CD44 + CD62L − ) harvested from naïve C57BL/6 mice or treated MC38 tumor-bearing mice following 24 h of co-culture with MC38 or no tumor cells. Gating strategy: Supplementary Fig. . A – H ; M , N ; P , Q Results of one experiment. I – K Results of two independent experiments. A N = 15: depleted; n = 7: IgG2b control. B – H N = 7: 90 Y-, 177 Lu-, 225 Ac-NM600 ± ICI; n = 5: 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI + αCD8, αCD8. I – K N = 17: 90 Y-, 177 Lu-, 225 Ac-NM600 ± ICI; n = 10: αCD8; n = 5: 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI + αCD8. M , N N = 5/treatment group and timepoint except n = 4: 90 Y-NM600 + ICI Day 4; 90 Y-, 177 Lu-, 225 Ac-NM600 + ICI Day 11. P , Q N = 5: naïve, 2 Gy 90 Y-NM600 + ICI; n = 6: ICI, 2 Gy 177 Lu-NM600 + ICI; n = 7: 2 Gy 225 Ac-NM600 + ICI. Unpaired two-tailed t-test was used to compare CD8 + frequency between groups. One-way ANOVA with Tukey’s HSD post hoc test was used to compare flow cytometry results between treatment groups for each marker and timepoint and TNF or IFNγ expression between treatment groups within each co-culture condition. Linear mixed models were used to compare tumor volumes over time between various treatment groups. Statistical testing of the pairwise contrasts was adjusted for multiple comparisons using Tukey’s method. Log-rank test was used to compare survival. Error bars are SEM. O Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p4 .

Article Snippet: CD8 + T cell depletion was performed by injection of anti-murine CD8α (Rat IgG2b, κ; Clone 2.43; BioXCell, Cat # BE0061) or IgG2b control (Rat IgG2b, κ; Clone LTF-2; BioXCell, Cat # BE0090) by 300 μg intraperitoneal injection on days −5, 0, and 5.

Techniques: Flow Cytometry, Control, Co-Culture Assay, Expressing, Staining, Two Tailed Test, Marker

MC38 tumor-bearing mice received IgG2b control on days −5/0/5 (IgG2b), or 0, 0.2 Gy (0.4625 kBq), 2 Gy (4.625 kBq), 8 Gy (18.5 kBq) 225 Ac-NM600 on day 1 ± ICI on days −3/0/3. A Body weights. B Complete blood counts on day 23. WBC white blood cells, LYM lymphocytes, PLT platelets, HGB hemoglobin, RBC red blood cells. C TNF and IFNγ on peripheral CD8 + effector memory cells (CD8 + CD44 + CD62L − ) from naïve or MC38 tumor-bearing mice receiving the indicated treatment and following 24 h of co-culture with MC38 or no tumor cells (from Fig. ). D – L MC38 tumor-bearing mice received 8 Gy 225 Ac-NM600 + ICI, 8 Gy 225 Ac-NM600, ICI, or were untreated (No Tx). D Experimental scheme. Created with BioRender.com. Tumor growth ( E ) and overall survival ( F ) are shown. G Complete response (CR) rates ( H ) and percent of CR mice and naïve controls rejecting rechallenge with MC38 cells are shown. I – K Flow cytometry of blood from CR (MC38, Ac + ICI) or naïve mice (MC38, naïve). L Flow cytometry of splenocytes from CR 225 Ac-NM600 + ICI mice that did not (Ac + ICI tumor) or did reject rechallenge (Ac + ICI no tumor), CR ICI mice (ICI), naïve C57BL/6 mice following IV injection of MC38 cells (MC38 IV), and completely naïve C57BL/6 mice (Naïve). Gating strategies: Supplementary Figs. – . A , B ; C ; E – L Results of one experiment. A N = 7: all groups. B N = 5: naïve, 2 Gy 90 Y-NM600 + ICI; n = 6: ICI, 2 Gy 177 Lu-NM600 + ICI; n = 7: 0.2, 2, 8 Gy 225 Ac-NM600 + ICI. C N = 5: naïve; n = 6: ICI; n = 7: 0.2, 2, 8 Gy 225 Ac-NM600 + ICI. E – G N = 5/treatment group. H N = 5: 225 Ac-NM600 + ICI, naïve; n = 3: ICI. I – K N = 4/treatment group. L N = 4: MC38 IV, Naïve; n = 3: ICI; n = 2: Ac + ICI tumor, Ac + ICI no tumor. One-way ANOVA with Tukey’s HSD post hoc test was used to compare TNF or IFNγ expression, blood counts, CR rates, rechallenge rejection rates, and spleen flow cytometry. Unpaired two-tailed t-test was used to compare blood flow cytometry. Tumor volumes were compared using linear mixed models adjusted for multiple comparisons using Tukey’s method. Log-rank test was used to compare survival. Error bars are SEM. D Created in BioRender. Berg, T. (2026) https://BioRender.com/llbyoho, .

Journal: Nature Communications

Article Title: Priming versus propagating: distinct immune effects of alpha- versus beta-particle emitting radiopharmaceuticals when combined with immune checkpoint inhibition in mice

doi: 10.1038/s41467-026-68834-1

Figure Lengend Snippet: MC38 tumor-bearing mice received IgG2b control on days −5/0/5 (IgG2b), or 0, 0.2 Gy (0.4625 kBq), 2 Gy (4.625 kBq), 8 Gy (18.5 kBq) 225 Ac-NM600 on day 1 ± ICI on days −3/0/3. A Body weights. B Complete blood counts on day 23. WBC white blood cells, LYM lymphocytes, PLT platelets, HGB hemoglobin, RBC red blood cells. C TNF and IFNγ on peripheral CD8 + effector memory cells (CD8 + CD44 + CD62L − ) from naïve or MC38 tumor-bearing mice receiving the indicated treatment and following 24 h of co-culture with MC38 or no tumor cells (from Fig. ). D – L MC38 tumor-bearing mice received 8 Gy 225 Ac-NM600 + ICI, 8 Gy 225 Ac-NM600, ICI, or were untreated (No Tx). D Experimental scheme. Created with BioRender.com. Tumor growth ( E ) and overall survival ( F ) are shown. G Complete response (CR) rates ( H ) and percent of CR mice and naïve controls rejecting rechallenge with MC38 cells are shown. I – K Flow cytometry of blood from CR (MC38, Ac + ICI) or naïve mice (MC38, naïve). L Flow cytometry of splenocytes from CR 225 Ac-NM600 + ICI mice that did not (Ac + ICI tumor) or did reject rechallenge (Ac + ICI no tumor), CR ICI mice (ICI), naïve C57BL/6 mice following IV injection of MC38 cells (MC38 IV), and completely naïve C57BL/6 mice (Naïve). Gating strategies: Supplementary Figs. – . A , B ; C ; E – L Results of one experiment. A N = 7: all groups. B N = 5: naïve, 2 Gy 90 Y-NM600 + ICI; n = 6: ICI, 2 Gy 177 Lu-NM600 + ICI; n = 7: 0.2, 2, 8 Gy 225 Ac-NM600 + ICI. C N = 5: naïve; n = 6: ICI; n = 7: 0.2, 2, 8 Gy 225 Ac-NM600 + ICI. E – G N = 5/treatment group. H N = 5: 225 Ac-NM600 + ICI, naïve; n = 3: ICI. I – K N = 4/treatment group. L N = 4: MC38 IV, Naïve; n = 3: ICI; n = 2: Ac + ICI tumor, Ac + ICI no tumor. One-way ANOVA with Tukey’s HSD post hoc test was used to compare TNF or IFNγ expression, blood counts, CR rates, rechallenge rejection rates, and spleen flow cytometry. Unpaired two-tailed t-test was used to compare blood flow cytometry. Tumor volumes were compared using linear mixed models adjusted for multiple comparisons using Tukey’s method. Log-rank test was used to compare survival. Error bars are SEM. D Created in BioRender. Berg, T. (2026) https://BioRender.com/llbyoho, .

Article Snippet: CD8 + T cell depletion was performed by injection of anti-murine CD8α (Rat IgG2b, κ; Clone 2.43; BioXCell, Cat # BE0061) or IgG2b control (Rat IgG2b, κ; Clone LTF-2; BioXCell, Cat # BE0090) by 300 μg intraperitoneal injection on days −5, 0, and 5.

Techniques: Control, Co-Culture Assay, Flow Cytometry, IV Injection, Expressing, Two Tailed Test

Paired TCR sequencing analysis performed on samples from B78 tumor-bearing mice used for single cell RNA sequencing. A – H Data presented are from samples from experiment depicted in Fig. . A UMAP plots of T cells stratified by sample. B TCR clonotype expansion ranges. C UMAP plots of T cells stratified by T cell subtype. D Clonal expansion by treatment group and T cell subtype. E D50 score by treatment group and T cell subtype. F Relative abundance of clonal indices for each treatment group and T cell subtype. G UpSet plot showing shared clonotypes between T cell subtypes for the 225 Ac-NM600 + ICI sample. Red box demarcates CD8 + effector and memory subsets; red arrow demarcates # of shared clonotypes between CD8 + effector and memory subsets (=11). H UpSet plots showing shared clonotypes between T cell subtypes for the 90 Y-, 177 Lu-, EBRT + ICI, and ICI alone samples. For each plot, red arrow demarcates # of shared clonotypes between CD8+ effector and memory subsets (=7 for each sample). A – H Results of one experiment. 3 mice/treatment group pooled into one sample/treatment group for TCR sequencing analysis. Numbers of cells analyzed provided in Supplementary Table . Number of cells analyzed: 90 Y-NM600 + ICI, n = 408; 177 Lu-NM600 + ICI, n = 993; 225 Ac-NM600 + ICI, n = 854; EBRT + ICI, n = 285; ICI, n = 977.

Journal: Nature Communications

Article Title: Priming versus propagating: distinct immune effects of alpha- versus beta-particle emitting radiopharmaceuticals when combined with immune checkpoint inhibition in mice

doi: 10.1038/s41467-026-68834-1

Figure Lengend Snippet: Paired TCR sequencing analysis performed on samples from B78 tumor-bearing mice used for single cell RNA sequencing. A – H Data presented are from samples from experiment depicted in Fig. . A UMAP plots of T cells stratified by sample. B TCR clonotype expansion ranges. C UMAP plots of T cells stratified by T cell subtype. D Clonal expansion by treatment group and T cell subtype. E D50 score by treatment group and T cell subtype. F Relative abundance of clonal indices for each treatment group and T cell subtype. G UpSet plot showing shared clonotypes between T cell subtypes for the 225 Ac-NM600 + ICI sample. Red box demarcates CD8 + effector and memory subsets; red arrow demarcates # of shared clonotypes between CD8 + effector and memory subsets (=11). H UpSet plots showing shared clonotypes between T cell subtypes for the 90 Y-, 177 Lu-, EBRT + ICI, and ICI alone samples. For each plot, red arrow demarcates # of shared clonotypes between CD8+ effector and memory subsets (=7 for each sample). A – H Results of one experiment. 3 mice/treatment group pooled into one sample/treatment group for TCR sequencing analysis. Numbers of cells analyzed provided in Supplementary Table . Number of cells analyzed: 90 Y-NM600 + ICI, n = 408; 177 Lu-NM600 + ICI, n = 993; 225 Ac-NM600 + ICI, n = 854; EBRT + ICI, n = 285; ICI, n = 977.

Article Snippet: CD8 + T cell depletion was performed by injection of anti-murine CD8α (Rat IgG2b, κ; Clone 2.43; BioXCell, Cat # BE0061) or IgG2b control (Rat IgG2b, κ; Clone LTF-2; BioXCell, Cat # BE0090) by 300 μg intraperitoneal injection on days −5, 0, and 5.

Techniques: Sequencing, Single Cell, RNA Sequencing

A – D Data presented are from samples from experiment depicted in Fig. . A Pathway enrichment results for CD8 + effector T cells. The bluer the pathway, the lower the adjusted P, and thus the more significantly the pathway is altered. Differential gene expression heat map for interferon γ ( B ) and interferon α ( C ) response genes for CD8 + effector T cells. The color of each box represents the log 2 (fold change) of gene expression of 225 Ac-, 177 Lu-, 90 Y-NM600, or EBRT + ICI compared to ICI alone. D Incidence matrix of differential gene expression between treatment groups of the following: comparing cells where the shared clonotypes between effector and memory CD8 + T cells are between 7 and 11 (as shown in Fig. ), and they are amplified. Red arrow marks interferon-inducible gene, Ifi27l2a , which is upregulated in these shared clonotype CD8 + cell populations treated with 225 Ac-NM600 + ICI over each treatment group. A – D Results of one experiment. 3 mice/treatment group pooled into one sample/treatment group for single cell RNA sequencing TCR sequencing analysis. Benjamini–Hochberg method was used to correct for multiple comparison. Numbers of cells analyzed provided in Supplementary Table A – C 90 Y-NM600 + ICI, n = 6067; 177 Lu-NM600 + ICI, n = 9808; 225 Ac-NM600 + ICI, n = 6503; EBRT + ICI, n = 7045; ICI, n = 11,249 and Supplementary Table D 90 Y-NM600 + ICI, n = 123; 177 Lu-NM600 + ICI, n = 151; 225 Ac-NM600 + ICI, n = 45; EBRT + ICI, n = 36; ICI, n = 100.

Journal: Nature Communications

Article Title: Priming versus propagating: distinct immune effects of alpha- versus beta-particle emitting radiopharmaceuticals when combined with immune checkpoint inhibition in mice

doi: 10.1038/s41467-026-68834-1

Figure Lengend Snippet: A – D Data presented are from samples from experiment depicted in Fig. . A Pathway enrichment results for CD8 + effector T cells. The bluer the pathway, the lower the adjusted P, and thus the more significantly the pathway is altered. Differential gene expression heat map for interferon γ ( B ) and interferon α ( C ) response genes for CD8 + effector T cells. The color of each box represents the log 2 (fold change) of gene expression of 225 Ac-, 177 Lu-, 90 Y-NM600, or EBRT + ICI compared to ICI alone. D Incidence matrix of differential gene expression between treatment groups of the following: comparing cells where the shared clonotypes between effector and memory CD8 + T cells are between 7 and 11 (as shown in Fig. ), and they are amplified. Red arrow marks interferon-inducible gene, Ifi27l2a , which is upregulated in these shared clonotype CD8 + cell populations treated with 225 Ac-NM600 + ICI over each treatment group. A – D Results of one experiment. 3 mice/treatment group pooled into one sample/treatment group for single cell RNA sequencing TCR sequencing analysis. Benjamini–Hochberg method was used to correct for multiple comparison. Numbers of cells analyzed provided in Supplementary Table A – C 90 Y-NM600 + ICI, n = 6067; 177 Lu-NM600 + ICI, n = 9808; 225 Ac-NM600 + ICI, n = 6503; EBRT + ICI, n = 7045; ICI, n = 11,249 and Supplementary Table D 90 Y-NM600 + ICI, n = 123; 177 Lu-NM600 + ICI, n = 151; 225 Ac-NM600 + ICI, n = 45; EBRT + ICI, n = 36; ICI, n = 100.

Article Snippet: CD8 + T cell depletion was performed by injection of anti-murine CD8α (Rat IgG2b, κ; Clone 2.43; BioXCell, Cat # BE0061) or IgG2b control (Rat IgG2b, κ; Clone LTF-2; BioXCell, Cat # BE0090) by 300 μg intraperitoneal injection on days −5, 0, and 5.

Techniques: Gene Expression, Amplification, Single Cell, RNA Sequencing, Sequencing, Comparison

a Tumor growth of 4T1-vector and 4T1-EGFR cells orthotopically implanted into the mammary fat pad ( n = 10/group). Tumor volumes were measured over time; ns, not significant. b Tumor weights at day 10 and day 21 post-implantation; bars represent mean ± SEM. c Lung metastases were analyzed at day 21 by histological analysis of HE-stained lung sections. Quantitative data are shown as mean ± SEM; statistical tests as indicated. d Cytokeratin-positive (CK⁺) tumor cells in inguinal (ILN) lymph nodes were quantified by flow cytometry at indicated time points. Total CK⁺ cell numbers were normalized using counting beads. Statistical analysis was performed using one-way ANOVA. Data are presented as mean ± SEM. e Representative immunofluorescence images showing the distribution of blood vessels (CD31, green) and lymphatic vessels (LYVE1, red) in 4T1-vector (left) and 4T1-EGFR (right) primary tumors. Nuclei are stained with Hoechst (blue). The main panel shows the overall vascular and lymphatic structure in the tumor tissue (scale bar = 1000 µm). Regions of interest (ROIs) from the tumor center (yellow box) and tumor periphery (purple box) are enlarged to show the detailed morphology and localization of blood and lymphatic vessels (scale bar = 200 µm).

Journal: NPJ Breast Cancer

Article Title: TGF-α/EGFR-mediated lymphatic metastasis reveals a repositionable therapeutic target in breast cancer

doi: 10.1038/s41523-026-00941-0

Figure Lengend Snippet: a Tumor growth of 4T1-vector and 4T1-EGFR cells orthotopically implanted into the mammary fat pad ( n = 10/group). Tumor volumes were measured over time; ns, not significant. b Tumor weights at day 10 and day 21 post-implantation; bars represent mean ± SEM. c Lung metastases were analyzed at day 21 by histological analysis of HE-stained lung sections. Quantitative data are shown as mean ± SEM; statistical tests as indicated. d Cytokeratin-positive (CK⁺) tumor cells in inguinal (ILN) lymph nodes were quantified by flow cytometry at indicated time points. Total CK⁺ cell numbers were normalized using counting beads. Statistical analysis was performed using one-way ANOVA. Data are presented as mean ± SEM. e Representative immunofluorescence images showing the distribution of blood vessels (CD31, green) and lymphatic vessels (LYVE1, red) in 4T1-vector (left) and 4T1-EGFR (right) primary tumors. Nuclei are stained with Hoechst (blue). The main panel shows the overall vascular and lymphatic structure in the tumor tissue (scale bar = 1000 µm). Regions of interest (ROIs) from the tumor center (yellow box) and tumor periphery (purple box) are enlarged to show the detailed morphology and localization of blood and lymphatic vessels (scale bar = 200 µm).

Article Snippet: 4T1 cells were from ATCC (American Type Culture Collection, VA) and cultured in RPMI and supplemented with 10% Fetal Bovine Serum (FBS, Thermo Fisher Scientific) and 1% penicillin + streptomycin.

Techniques: Plasmid Preparation, Staining, Flow Cytometry, Immunofluorescence

a Genes upregulated upon TGF-β1-mediated activation of svLEC cells and encoding extracellular proteins were analyzed for their involvement in Ligand–receptor interactions using the PhoneDB database. Corresponding receptors are shown in red and ligands in blue. The size of each receptor node reflects the number of interacting ligands. b Single-cell RNA-seq analysis using breast cancer and matched metastatic lymph node samples from dataset GSE167036 , focusing on the endothelial cell compartment. UMAP visualization revealed five distinct endothelial subpopulations from both primary tumor and LN metastasis, characterized by the expression of ACKR1, CD36, PROX1, SEMA3G, and INSR. Dot plot showing the expression of TGFA, AREG, EREG, HBEGF, EGF, and CTGF across endothelial subpopulations. Dot size represents the percentage of cells expressing each gene, and color intensity indicates average log-normalized expression levels. c Western blot analysis of TGFα, CTGF, EREG, and HB-EGF expression in svLEC cell lysates and conditioned media (ConM) following TGF-β1 treatment and after overnight incubation (O/N) in TGF-β1-free medium. GAPDH was used as a loading control for cell lysates. For conditioned media, sample loading was normalized to cell number. d Feature plots show the spatial distribution of CTGF and TGFA expression across UMAP. Violin plots illustrate that the expression of TGFα and CTGF is enriched in lymphatic and blood endothelial cells, respectively. Gene expressions are displayed as log-normalized values. e Immunofluorescence images showing staining of growth factors (TGFα and CTGF, yellow) in lymphatic (LYVE1+, red) and blood vessels (CD31+, green), respectively, 4T1-vector (left) and 4T1-EGFR (right) tumors (scale bar = 100 µm). Quantification of median TGFα and CTGF signal intensity within regions positive for CD31 and LYVE-1. 20 areas (Regions of Interest ROIs) per group. n = 10 per group. Statistical analysis was performed using an unpaired two-tailed Student’s T-test. Data are presented as mean ± SEM.

Journal: NPJ Breast Cancer

Article Title: TGF-α/EGFR-mediated lymphatic metastasis reveals a repositionable therapeutic target in breast cancer

doi: 10.1038/s41523-026-00941-0

Figure Lengend Snippet: a Genes upregulated upon TGF-β1-mediated activation of svLEC cells and encoding extracellular proteins were analyzed for their involvement in Ligand–receptor interactions using the PhoneDB database. Corresponding receptors are shown in red and ligands in blue. The size of each receptor node reflects the number of interacting ligands. b Single-cell RNA-seq analysis using breast cancer and matched metastatic lymph node samples from dataset GSE167036 , focusing on the endothelial cell compartment. UMAP visualization revealed five distinct endothelial subpopulations from both primary tumor and LN metastasis, characterized by the expression of ACKR1, CD36, PROX1, SEMA3G, and INSR. Dot plot showing the expression of TGFA, AREG, EREG, HBEGF, EGF, and CTGF across endothelial subpopulations. Dot size represents the percentage of cells expressing each gene, and color intensity indicates average log-normalized expression levels. c Western blot analysis of TGFα, CTGF, EREG, and HB-EGF expression in svLEC cell lysates and conditioned media (ConM) following TGF-β1 treatment and after overnight incubation (O/N) in TGF-β1-free medium. GAPDH was used as a loading control for cell lysates. For conditioned media, sample loading was normalized to cell number. d Feature plots show the spatial distribution of CTGF and TGFA expression across UMAP. Violin plots illustrate that the expression of TGFα and CTGF is enriched in lymphatic and blood endothelial cells, respectively. Gene expressions are displayed as log-normalized values. e Immunofluorescence images showing staining of growth factors (TGFα and CTGF, yellow) in lymphatic (LYVE1+, red) and blood vessels (CD31+, green), respectively, 4T1-vector (left) and 4T1-EGFR (right) tumors (scale bar = 100 µm). Quantification of median TGFα and CTGF signal intensity within regions positive for CD31 and LYVE-1. 20 areas (Regions of Interest ROIs) per group. n = 10 per group. Statistical analysis was performed using an unpaired two-tailed Student’s T-test. Data are presented as mean ± SEM.

Article Snippet: 4T1 cells were from ATCC (American Type Culture Collection, VA) and cultured in RPMI and supplemented with 10% Fetal Bovine Serum (FBS, Thermo Fisher Scientific) and 1% penicillin + streptomycin.

Techniques: Activation Assay, Single Cell, RNA Sequencing, Expressing, Western Blot, Incubation, Control, Immunofluorescence, Staining, Plasmid Preparation, Two Tailed Test

Transwell invasion assays of 4T1-vector and 4T1-EGFR cells toward conditioned medium (CondM) from svLECs, with or without prior TGF-β1 stimulation ( a ), or serum-free medium supplemented with recombinant TGF-α, CTGF, or both ( b ). Three fields per well were analyzed across three independent experiments by quantifying the crystal violet-stained area. Statistical analysis was performed using two-way ANOVA. c , d Directional migration of 4T1-EGFR cells was assessed using chemotaxis assays and quantified by the Forward Migration Index (FMI). The significance of vectorial migration was evaluated using the Rayleigh test. As indicated by the dashed line, each condition is assessed relative to its own “zero directionality” reference. c Chemotactic responses to svLEC-conditioned medium (CondM) were examined, with control medium and EGF serving as negative and positive controls for assay performance. d Directed migration in response to defined EGFR ligands was assessed using gradients of CTGF or TGFα. In the combined condition, CTGF and TGFα were placed in opposing reservoirs to model competitive chemotaxis.

Journal: NPJ Breast Cancer

Article Title: TGF-α/EGFR-mediated lymphatic metastasis reveals a repositionable therapeutic target in breast cancer

doi: 10.1038/s41523-026-00941-0

Figure Lengend Snippet: Transwell invasion assays of 4T1-vector and 4T1-EGFR cells toward conditioned medium (CondM) from svLECs, with or without prior TGF-β1 stimulation ( a ), or serum-free medium supplemented with recombinant TGF-α, CTGF, or both ( b ). Three fields per well were analyzed across three independent experiments by quantifying the crystal violet-stained area. Statistical analysis was performed using two-way ANOVA. c , d Directional migration of 4T1-EGFR cells was assessed using chemotaxis assays and quantified by the Forward Migration Index (FMI). The significance of vectorial migration was evaluated using the Rayleigh test. As indicated by the dashed line, each condition is assessed relative to its own “zero directionality” reference. c Chemotactic responses to svLEC-conditioned medium (CondM) were examined, with control medium and EGF serving as negative and positive controls for assay performance. d Directed migration in response to defined EGFR ligands was assessed using gradients of CTGF or TGFα. In the combined condition, CTGF and TGFα were placed in opposing reservoirs to model competitive chemotaxis.

Article Snippet: 4T1 cells were from ATCC (American Type Culture Collection, VA) and cultured in RPMI and supplemented with 10% Fetal Bovine Serum (FBS, Thermo Fisher Scientific) and 1% penicillin + streptomycin.

Techniques: Plasmid Preparation, Recombinant, Staining, Migration, Chemotaxis Assay, Control

a – c Western blot analysis of the effect of svLEC-conditioned medium ( a , svLEC), TGF-α ( b ), or CTGF ( c ) on phosphorylated and total proteins in the EGFR signaling pathway. Expression levels of phosphorylated and total STAT3, MAPK, and AKT were assessed. GAPDH was used as a loading control. d Signal intensities were quantified using ImageJ, and phosphorylation levels were normalized to the corresponding total protein and further to GAPDH. All targets were probed on the same membrane per experiment. Results from three independent biological replicates were quantified. Normalized values were processed in GraphPad Prism and visualized as a heatmap. e The STAT3 inhibitor Stattic was used to assess the role of STAT3 signaling in tumor cell invasion. Transwell invasion assay showing the invasive capacity of 4T1-EGFR cells toward svLEC-conditioned media in the presence of Stattic. DMSO was used as vehicle control. For each condition, three fields per well were imaged and quantified across three independent experiments based on crystal violet-stained areas. Statistical analysis was performed using an unpaired two-tailed Student’s T-test. Data are presented as mean ± SEM.

Journal: NPJ Breast Cancer

Article Title: TGF-α/EGFR-mediated lymphatic metastasis reveals a repositionable therapeutic target in breast cancer

doi: 10.1038/s41523-026-00941-0

Figure Lengend Snippet: a – c Western blot analysis of the effect of svLEC-conditioned medium ( a , svLEC), TGF-α ( b ), or CTGF ( c ) on phosphorylated and total proteins in the EGFR signaling pathway. Expression levels of phosphorylated and total STAT3, MAPK, and AKT were assessed. GAPDH was used as a loading control. d Signal intensities were quantified using ImageJ, and phosphorylation levels were normalized to the corresponding total protein and further to GAPDH. All targets were probed on the same membrane per experiment. Results from three independent biological replicates were quantified. Normalized values were processed in GraphPad Prism and visualized as a heatmap. e The STAT3 inhibitor Stattic was used to assess the role of STAT3 signaling in tumor cell invasion. Transwell invasion assay showing the invasive capacity of 4T1-EGFR cells toward svLEC-conditioned media in the presence of Stattic. DMSO was used as vehicle control. For each condition, three fields per well were imaged and quantified across three independent experiments based on crystal violet-stained areas. Statistical analysis was performed using an unpaired two-tailed Student’s T-test. Data are presented as mean ± SEM.

Article Snippet: 4T1 cells were from ATCC (American Type Culture Collection, VA) and cultured in RPMI and supplemented with 10% Fetal Bovine Serum (FBS, Thermo Fisher Scientific) and 1% penicillin + streptomycin.

Techniques: Western Blot, Expressing, Control, Phospho-proteomics, Membrane, Transwell Invasion Assay, Staining, Two Tailed Test

Studies were performed to analyze whether blockade of TGF-α could inhibit chemotactic invasion and lymphatic metastasis of 4T1-EGFR cells. a Results from transwell invasion assays showing that Fepixnebart, a neutralizing antibody against TGFα (aTGFα), significantly inhibited chemotactic invasion of 4T1-EGFR cells toward svLEC-conditioned media. An isotype matched IgG antibody was used as control. For each condition, three fields per well were imaged and quantified across three independent experiments based on crystal violet-stained areas. Statistical analysis was performed using an unpaired two-tailed Student’s T-test. b Schematic overview of the in vivo experimental setup. 4T1 cells were orthotopically implanted into mice, followed by tail vein injection of Fepixnebart. Tumor-draining lymph nodes were collected for analysis 10 days later. c Bar graphs showing quantification of CK⁺ tumor cells in inguinal (ILN) and axillary (ALN) lymph nodes 10 days after orthotopic injection of 4T1-EGFR cells into mammary fat pads. Mice received a single intravenous injection of Fepixnebart (10 mg/kg; n = 9) or isotype IgG control ( n = 8) at the time of tumor cell implantation. Data are shown as mean ± SEM; statistical analysis by unpaired two-tailed Student’s t-test.

Journal: NPJ Breast Cancer

Article Title: TGF-α/EGFR-mediated lymphatic metastasis reveals a repositionable therapeutic target in breast cancer

doi: 10.1038/s41523-026-00941-0

Figure Lengend Snippet: Studies were performed to analyze whether blockade of TGF-α could inhibit chemotactic invasion and lymphatic metastasis of 4T1-EGFR cells. a Results from transwell invasion assays showing that Fepixnebart, a neutralizing antibody against TGFα (aTGFα), significantly inhibited chemotactic invasion of 4T1-EGFR cells toward svLEC-conditioned media. An isotype matched IgG antibody was used as control. For each condition, three fields per well were imaged and quantified across three independent experiments based on crystal violet-stained areas. Statistical analysis was performed using an unpaired two-tailed Student’s T-test. b Schematic overview of the in vivo experimental setup. 4T1 cells were orthotopically implanted into mice, followed by tail vein injection of Fepixnebart. Tumor-draining lymph nodes were collected for analysis 10 days later. c Bar graphs showing quantification of CK⁺ tumor cells in inguinal (ILN) and axillary (ALN) lymph nodes 10 days after orthotopic injection of 4T1-EGFR cells into mammary fat pads. Mice received a single intravenous injection of Fepixnebart (10 mg/kg; n = 9) or isotype IgG control ( n = 8) at the time of tumor cell implantation. Data are shown as mean ± SEM; statistical analysis by unpaired two-tailed Student’s t-test.

Article Snippet: 4T1 cells were from ATCC (American Type Culture Collection, VA) and cultured in RPMI and supplemented with 10% Fetal Bovine Serum (FBS, Thermo Fisher Scientific) and 1% penicillin + streptomycin.

Techniques: Control, Staining, Two Tailed Test, In Vivo, Injection

a Total number of cells in inguinal lymph nodes (ILN) compared to non-draining lymph node (NDLN) at day 10, and day 21 following orthotopic implantation of 4T1-vector or 4T1-EGFR cells. Percentage of CD3⁺ T cells ( b ), CD8 + T cells ( c ), and Foxp3⁺ regulatory T cells ( d ) in ILN compared to NDLN at day 10, and day 21 following orthotopic implantation of 4T1-vector or 4T1-EGFR cells. Each dot represents one lymph node; group means ± SEM shown. Statistical analysis was performed by two-way ANOVA with post hoc test.

Journal: NPJ Breast Cancer

Article Title: TGF-α/EGFR-mediated lymphatic metastasis reveals a repositionable therapeutic target in breast cancer

doi: 10.1038/s41523-026-00941-0

Figure Lengend Snippet: a Total number of cells in inguinal lymph nodes (ILN) compared to non-draining lymph node (NDLN) at day 10, and day 21 following orthotopic implantation of 4T1-vector or 4T1-EGFR cells. Percentage of CD3⁺ T cells ( b ), CD8 + T cells ( c ), and Foxp3⁺ regulatory T cells ( d ) in ILN compared to NDLN at day 10, and day 21 following orthotopic implantation of 4T1-vector or 4T1-EGFR cells. Each dot represents one lymph node; group means ± SEM shown. Statistical analysis was performed by two-way ANOVA with post hoc test.

Article Snippet: 4T1 cells were from ATCC (American Type Culture Collection, VA) and cultured in RPMI and supplemented with 10% Fetal Bovine Serum (FBS, Thermo Fisher Scientific) and 1% penicillin + streptomycin.

Techniques: Plasmid Preparation

Prediction of ICI outcomes using the FD.sig model with IFN-γ as a key factor. ( A ) Flowchart of constructing FD.model for ICI prediction response. ( B ) The volcano plot of FD.score between tumor and normal tissues in TCGA data; ( C ) Survival analysis of FD.score in TCGA-SKCM. ( D ) ROC curves of eight machine-learning methods in testing set. ( E ) AUCs of eight methods in training and testing sets. ( F ) Comparison of AUCs between FD.sig and other signatures in training and testing sets. ( G ) Comparison of AUCs between FD.sig and other signatures in each cohort. ( H ) The importance ranking of genes in FD.model. ( I ) Comparison of IFNG expression on T cells between responder, non-responder and treatment-naïve in GSE115978 . ( J–K ) Cell viability of A375 cells and H1299 cells treated with different concentrations of RSL3/RSL3+Fer-1 for 24 hours after IFN-γ incubation for 0–72 hours (n=3), IFN-γ: 100 mg/mL, Fer-1: 1 µM. ( L–M ) Relative ROS level of A375 ( L ) and H1299 cells ( M ) treated with RSL3/RSL3+Fer-1 for 3 hours after IFN-γ incubation for 48 hours (n=3), IFN-γ: 60 mg/mL, RSL3: 500 nM, Fer-1: 1 µM. AUC, area under the receiver operating characteristic curve; BLCA, bladder urothelial carcinoma; BRCA, breast cancer; CRAD, colorectal adenocarcinoma; FD.model, ferroptosis-based machine learning model; FD.sig, ferroptosis-driver signature; HNSC, head and neck squamous carcinoma; ICI, immune checkpoint inhibitor; IFN, interferon; KICH, kidney chromophobe; KIRC, kidney renal clear cell carcinoma; KIRP, kidney renal papillary cell carcinoma; LIHC, liver hepatocellular carcinoma; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; NR, non-responders; OS, overall survival; PRAD, prostate adenocarcinoma; R, responders; ROC, receiver operating characteristic; ROS, reactive oxygen species; scRNA-seq, single-cell RNA sequencing; SKCM, skin cutaneous melanoma; STAD, stomach adenocarcinoma; TCGA, The Cancer Genome Atlas; THCA, thyroid carcinoma.

Journal: Journal for Immunotherapy of Cancer

Article Title: AGPAT3 reshapes tumor cell vulnerability to IFNγ-mediated ferroptosis and enhances immunotherapy efficacy through lipid remodeling

doi: 10.1136/jitc-2025-013305

Figure Lengend Snippet: Prediction of ICI outcomes using the FD.sig model with IFN-γ as a key factor. ( A ) Flowchart of constructing FD.model for ICI prediction response. ( B ) The volcano plot of FD.score between tumor and normal tissues in TCGA data; ( C ) Survival analysis of FD.score in TCGA-SKCM. ( D ) ROC curves of eight machine-learning methods in testing set. ( E ) AUCs of eight methods in training and testing sets. ( F ) Comparison of AUCs between FD.sig and other signatures in training and testing sets. ( G ) Comparison of AUCs between FD.sig and other signatures in each cohort. ( H ) The importance ranking of genes in FD.model. ( I ) Comparison of IFNG expression on T cells between responder, non-responder and treatment-naïve in GSE115978 . ( J–K ) Cell viability of A375 cells and H1299 cells treated with different concentrations of RSL3/RSL3+Fer-1 for 24 hours after IFN-γ incubation for 0–72 hours (n=3), IFN-γ: 100 mg/mL, Fer-1: 1 µM. ( L–M ) Relative ROS level of A375 ( L ) and H1299 cells ( M ) treated with RSL3/RSL3+Fer-1 for 3 hours after IFN-γ incubation for 48 hours (n=3), IFN-γ: 60 mg/mL, RSL3: 500 nM, Fer-1: 1 µM. AUC, area under the receiver operating characteristic curve; BLCA, bladder urothelial carcinoma; BRCA, breast cancer; CRAD, colorectal adenocarcinoma; FD.model, ferroptosis-based machine learning model; FD.sig, ferroptosis-driver signature; HNSC, head and neck squamous carcinoma; ICI, immune checkpoint inhibitor; IFN, interferon; KICH, kidney chromophobe; KIRC, kidney renal clear cell carcinoma; KIRP, kidney renal papillary cell carcinoma; LIHC, liver hepatocellular carcinoma; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; NR, non-responders; OS, overall survival; PRAD, prostate adenocarcinoma; R, responders; ROC, receiver operating characteristic; ROS, reactive oxygen species; scRNA-seq, single-cell RNA sequencing; SKCM, skin cutaneous melanoma; STAD, stomach adenocarcinoma; TCGA, The Cancer Genome Atlas; THCA, thyroid carcinoma.

Article Snippet: Human melanoma cell line A375 was purchased from FuHeng Biology (Shanghai, China), while the human lung cancer cell line H1299, mouse melanoma cell line B16F10 (B16), and mouse lung cancer cell line lewis lung carcinoma (LLC) were purchased from American Type Culture Collection (ATCC).

Techniques: Comparison, Expressing, Incubation, Single Cell, RNA Sequencing

IFN-γ induces the sensitivity of ferroptosis through lipid remodeling. ( A–B ) Ratios of different lipids in A375 cells and H1299 cells after IFN-γ incubation for different times, IFN-γ: 60 mg/mL. ( C ) Differential analysis of free fatty acids compared the control group with IFN-γ incubation groups in A375 cells and H1299 cells, IFN-γ: 60 mg/mL. ( D ) Ratios of ether lipids and ester lipids in H1299 cells after IFN-γ incubation, IFN-γ: 60 mg/mL. ( E–F ) Heatmap of ether-PC and ether-PE in A375 ( E ) and H1299 cells ( F ) after IFN-γ incubation, IFN-γ: 60 mg/mL. FA, fatty acyls; GL, glycerolipids; GP, glycerophospholipids; IFN, interferon; MUFA, monounsaturated fatty acid; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PR, prenol lipids; PUFA, polyunsaturated fatty acid; SFA, saturated fatty acid; SP, sphingolipids; ST, sterol lipids.

Journal: Journal for Immunotherapy of Cancer

Article Title: AGPAT3 reshapes tumor cell vulnerability to IFNγ-mediated ferroptosis and enhances immunotherapy efficacy through lipid remodeling

doi: 10.1136/jitc-2025-013305

Figure Lengend Snippet: IFN-γ induces the sensitivity of ferroptosis through lipid remodeling. ( A–B ) Ratios of different lipids in A375 cells and H1299 cells after IFN-γ incubation for different times, IFN-γ: 60 mg/mL. ( C ) Differential analysis of free fatty acids compared the control group with IFN-γ incubation groups in A375 cells and H1299 cells, IFN-γ: 60 mg/mL. ( D ) Ratios of ether lipids and ester lipids in H1299 cells after IFN-γ incubation, IFN-γ: 60 mg/mL. ( E–F ) Heatmap of ether-PC and ether-PE in A375 ( E ) and H1299 cells ( F ) after IFN-γ incubation, IFN-γ: 60 mg/mL. FA, fatty acyls; GL, glycerolipids; GP, glycerophospholipids; IFN, interferon; MUFA, monounsaturated fatty acid; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PR, prenol lipids; PUFA, polyunsaturated fatty acid; SFA, saturated fatty acid; SP, sphingolipids; ST, sterol lipids.

Article Snippet: Human melanoma cell line A375 was purchased from FuHeng Biology (Shanghai, China), while the human lung cancer cell line H1299, mouse melanoma cell line B16F10 (B16), and mouse lung cancer cell line lewis lung carcinoma (LLC) were purchased from American Type Culture Collection (ATCC).

Techniques: Incubation, Control

IFN-γ induces the sensitivity of ferroptosis through ether lipids. ( A, C ) Volcano plot of ether-PC and ether-PE compared the control group with IFN-γ incubation groups in A375 cells and H1299 cells, IFN-γ: 60 mg/mL. ( B, D ) Intersection Venn diagram of differential lipids in A375 cells and H1299 cells. ( E–J ) Cell viability of A375 and H1299 cells treated with RSL3/RSL3+Fer-1 for 12 hours after incubation with indicated phospholipids, including PC 18_18:1 ( E ), PE 18_18:1 ( F ), PC 18_20:4 ( G ), PE 18_20:4 ( H ), PC 18_22:6 ( I ), PE 18_22:6 ( J ), phospholipids: 25 µM, Fer-1: 1 µm. ( K ) Comparison of lipid metabolism pathways with transcriptome data among groups with different IFN-γ incubation times in A375 cells and H1299 cells, IFN-γ: 60 mg/mL. IFN, interferon; PC, phosphatidylcholine; PE, phosphatidylethanolamine.

Journal: Journal for Immunotherapy of Cancer

Article Title: AGPAT3 reshapes tumor cell vulnerability to IFNγ-mediated ferroptosis and enhances immunotherapy efficacy through lipid remodeling

doi: 10.1136/jitc-2025-013305

Figure Lengend Snippet: IFN-γ induces the sensitivity of ferroptosis through ether lipids. ( A, C ) Volcano plot of ether-PC and ether-PE compared the control group with IFN-γ incubation groups in A375 cells and H1299 cells, IFN-γ: 60 mg/mL. ( B, D ) Intersection Venn diagram of differential lipids in A375 cells and H1299 cells. ( E–J ) Cell viability of A375 and H1299 cells treated with RSL3/RSL3+Fer-1 for 12 hours after incubation with indicated phospholipids, including PC 18_18:1 ( E ), PE 18_18:1 ( F ), PC 18_20:4 ( G ), PE 18_20:4 ( H ), PC 18_22:6 ( I ), PE 18_22:6 ( J ), phospholipids: 25 µM, Fer-1: 1 µm. ( K ) Comparison of lipid metabolism pathways with transcriptome data among groups with different IFN-γ incubation times in A375 cells and H1299 cells, IFN-γ: 60 mg/mL. IFN, interferon; PC, phosphatidylcholine; PE, phosphatidylethanolamine.

Article Snippet: Human melanoma cell line A375 was purchased from FuHeng Biology (Shanghai, China), while the human lung cancer cell line H1299, mouse melanoma cell line B16F10 (B16), and mouse lung cancer cell line lewis lung carcinoma (LLC) were purchased from American Type Culture Collection (ATCC).

Techniques: Control, Incubation, Comparison

IFN-γ alters the ether lipid metabolism via the IRF1-AGPAT3 axis. ( A ) Schematic summarizing the PUFA-ePLs biosynthesis pathway and their contribution to ferroptosis susceptibility. ( B ) Heatmap of different groups on the expression of specific genes in A375 cells and H1299 cells. ( C ) Representative western blot for AGPS, AGPAT3 and GNPAT in A375 cells and H1299 cells after IFN-γ incubation, IFN-γ: 60 mg/mL. ( D ) Cell viability of different groups treated with different concentrations of RSL3/RSL3+Fer-1 for 24 hours after IFN-γ incubation for 48 hours (n=3), IFN-γ: 100 mg/mL, Fer-1: 1 µM. ( E ) Relative ROS level of different groups treated with RSL3/RSL3+Fer-1 for 3 hours after IFN-γ incubation for 48 hours (n=3), IFN-γ: 60 mg/mL, RSL3: 500 nM, Fer-1: 1 µM. ( F ) Heatmap of different groups on the expression of IFN-γ downstream transcription factors in A375 cells and H1299 cells. ( G–H ) IRF1 binding sites at the AGPAT3 promoter region in lung cancer cell lines from GSE186168 ChIP-seq data. ( I–J ) The peak of IRF1 binding at the Agpat3 promoter region becomes higher after IFN-γ incubation from GSE201881 ( I ) and GSE141606 ( J ) ChIP-seq data. ( K ) IRF1 binding sites at the AGPAT3 promoter region in A375 from CUT&Tag data. ChIP-seq, chromatin Immunoprecipitation sequencing; CUT&Tag, Cleavage Under Targets and Tagmentation; IFN, interferon; PUFA-ePLs, polyunsaturated ether phospholipids; ROS, reactive oxygen species.

Journal: Journal for Immunotherapy of Cancer

Article Title: AGPAT3 reshapes tumor cell vulnerability to IFNγ-mediated ferroptosis and enhances immunotherapy efficacy through lipid remodeling

doi: 10.1136/jitc-2025-013305

Figure Lengend Snippet: IFN-γ alters the ether lipid metabolism via the IRF1-AGPAT3 axis. ( A ) Schematic summarizing the PUFA-ePLs biosynthesis pathway and their contribution to ferroptosis susceptibility. ( B ) Heatmap of different groups on the expression of specific genes in A375 cells and H1299 cells. ( C ) Representative western blot for AGPS, AGPAT3 and GNPAT in A375 cells and H1299 cells after IFN-γ incubation, IFN-γ: 60 mg/mL. ( D ) Cell viability of different groups treated with different concentrations of RSL3/RSL3+Fer-1 for 24 hours after IFN-γ incubation for 48 hours (n=3), IFN-γ: 100 mg/mL, Fer-1: 1 µM. ( E ) Relative ROS level of different groups treated with RSL3/RSL3+Fer-1 for 3 hours after IFN-γ incubation for 48 hours (n=3), IFN-γ: 60 mg/mL, RSL3: 500 nM, Fer-1: 1 µM. ( F ) Heatmap of different groups on the expression of IFN-γ downstream transcription factors in A375 cells and H1299 cells. ( G–H ) IRF1 binding sites at the AGPAT3 promoter region in lung cancer cell lines from GSE186168 ChIP-seq data. ( I–J ) The peak of IRF1 binding at the Agpat3 promoter region becomes higher after IFN-γ incubation from GSE201881 ( I ) and GSE141606 ( J ) ChIP-seq data. ( K ) IRF1 binding sites at the AGPAT3 promoter region in A375 from CUT&Tag data. ChIP-seq, chromatin Immunoprecipitation sequencing; CUT&Tag, Cleavage Under Targets and Tagmentation; IFN, interferon; PUFA-ePLs, polyunsaturated ether phospholipids; ROS, reactive oxygen species.

Article Snippet: Human melanoma cell line A375 was purchased from FuHeng Biology (Shanghai, China), while the human lung cancer cell line H1299, mouse melanoma cell line B16F10 (B16), and mouse lung cancer cell line lewis lung carcinoma (LLC) were purchased from American Type Culture Collection (ATCC).

Techniques: Expressing, Western Blot, Incubation, Binding Assay, ChIP-sequencing

IFN-γ alters the ether lipid metabolism via the IRF1-AGPAT3 axis. ( A–B ) Changes in ratio of ether lipids and eater lipids in A375 and H1299 cells in NC, sh-AGPAT3 and sh-AGPAT3+IFN-γ group, IFN-γ: 60 mg/mL. ( C–D ) Changes in ratio of different ether lipids in A375 and H1299 cells in NC, sh-AGPAT3 and sh-AGPAT3+IFN-γ group, IFN-γ: 60 mg/mL. ( E–F ) Heatmap of ether-PC and ether-PE in A375 ( E ) and H1299 cells ( F ) in different groups, IFN-γ: 60 mg/mL. IFN, interferon; NC, normal control; PC, phosphatidylcholine; PE, phosphatidylethanolamine.

Journal: Journal for Immunotherapy of Cancer

Article Title: AGPAT3 reshapes tumor cell vulnerability to IFNγ-mediated ferroptosis and enhances immunotherapy efficacy through lipid remodeling

doi: 10.1136/jitc-2025-013305

Figure Lengend Snippet: IFN-γ alters the ether lipid metabolism via the IRF1-AGPAT3 axis. ( A–B ) Changes in ratio of ether lipids and eater lipids in A375 and H1299 cells in NC, sh-AGPAT3 and sh-AGPAT3+IFN-γ group, IFN-γ: 60 mg/mL. ( C–D ) Changes in ratio of different ether lipids in A375 and H1299 cells in NC, sh-AGPAT3 and sh-AGPAT3+IFN-γ group, IFN-γ: 60 mg/mL. ( E–F ) Heatmap of ether-PC and ether-PE in A375 ( E ) and H1299 cells ( F ) in different groups, IFN-γ: 60 mg/mL. IFN, interferon; NC, normal control; PC, phosphatidylcholine; PE, phosphatidylethanolamine.

Article Snippet: Human melanoma cell line A375 was purchased from FuHeng Biology (Shanghai, China), while the human lung cancer cell line H1299, mouse melanoma cell line B16F10 (B16), and mouse lung cancer cell line lewis lung carcinoma (LLC) were purchased from American Type Culture Collection (ATCC).

Techniques: Control

A – C Myc-CaP tumor-bearing mice received the indicated treatment. A Experimental scheme. Tumor growth ( B ) and overall survival ( C ) are shown. D – H Single cell RNA sequencing of B78 tumors. D Cell type fractions in lymphoid compartment. Cell types having >5% fraction in at least one sample are represented. E Single cell RNA sequencing treatment scheme. B78 tumor-bearing mice received either 2 Gy 90 Y-, 177 Lu-, 225 Ac-NM600 or EBRT + ICI (anti-CTLA4 and anti-PD-L1) on days −3/0/3 or ICI alone. Tumors were harvested on day 15, dissociated, and immune cells were isolated by Ficoll density gradient centrifugation for single cell RNA sequencing analysis. Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p . F UMAP of single cell RNA sequencing data colored by samples. Each panel shows identical cell population with one sample in color and all the others in gray. Regions containing T cells, myeloid cells, B cells, and epithelial cells/fibroblasts are indicated. G Representative B78 tumor photomicrographs for B cell marker CD20 at day 15 following 2 Gy 90 Y-, 177 Lu-, 225 Ac-NM600 or 2 Gy EBRT + ICI or ICI alone; brown = positive immunolabeling. H Quantification of CD20 + cell clusters/tumor. Cell cluster: ≥5 cells. Scale bar = 200 μm. B – H Results of one experiment. B , C n = 10/treatment group. D – F 3 mice/treatment group pooled into one sample/treatment group for single cell RNA sequencing analysis. Numbers of cells analyzed provided in Supplementary Table . 90 Y-NM600 + ICI, n = 6067; 177 Lu-NM600 + ICI, n = 9808; 225 Ac-NM600 + ICI, n = 6503; EBRT + ICI, n = 7045; ICI, n = 11,249. D – F n = 3 tumors/treatment group. G Representative image/treatment group from ( H ). H n = 4 tumors: 177 Lu-NM600 + ICI; n = 3 tumors: 90 Y-NM600 + ICI, 225 Ac-NM600 + ICI, EBRT + ICI, ICI. Linear mixed models were used to compare tumor volumes over time between various treatment groups. Statistical testing of the pairwise contrasts was adjusted for multiple comparisons using Tukey’s method. Log-rank test was used to compare survival. One-way ANOVA with Tukey’s HSD post hoc test was used to compare CD20 IHC quantification between treatment groups. Error bars are SEM. E Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p4 .

Journal: Nature Communications

Article Title: Priming versus propagating: distinct immune effects of alpha- versus beta-particle emitting radiopharmaceuticals when combined with immune checkpoint inhibition in mice

doi: 10.1038/s41467-026-68834-1

Figure Lengend Snippet: A – C Myc-CaP tumor-bearing mice received the indicated treatment. A Experimental scheme. Tumor growth ( B ) and overall survival ( C ) are shown. D – H Single cell RNA sequencing of B78 tumors. D Cell type fractions in lymphoid compartment. Cell types having >5% fraction in at least one sample are represented. E Single cell RNA sequencing treatment scheme. B78 tumor-bearing mice received either 2 Gy 90 Y-, 177 Lu-, 225 Ac-NM600 or EBRT + ICI (anti-CTLA4 and anti-PD-L1) on days −3/0/3 or ICI alone. Tumors were harvested on day 15, dissociated, and immune cells were isolated by Ficoll density gradient centrifugation for single cell RNA sequencing analysis. Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p . F UMAP of single cell RNA sequencing data colored by samples. Each panel shows identical cell population with one sample in color and all the others in gray. Regions containing T cells, myeloid cells, B cells, and epithelial cells/fibroblasts are indicated. G Representative B78 tumor photomicrographs for B cell marker CD20 at day 15 following 2 Gy 90 Y-, 177 Lu-, 225 Ac-NM600 or 2 Gy EBRT + ICI or ICI alone; brown = positive immunolabeling. H Quantification of CD20 + cell clusters/tumor. Cell cluster: ≥5 cells. Scale bar = 200 μm. B – H Results of one experiment. B , C n = 10/treatment group. D – F 3 mice/treatment group pooled into one sample/treatment group for single cell RNA sequencing analysis. Numbers of cells analyzed provided in Supplementary Table . 90 Y-NM600 + ICI, n = 6067; 177 Lu-NM600 + ICI, n = 9808; 225 Ac-NM600 + ICI, n = 6503; EBRT + ICI, n = 7045; ICI, n = 11,249. D – F n = 3 tumors/treatment group. G Representative image/treatment group from ( H ). H n = 4 tumors: 177 Lu-NM600 + ICI; n = 3 tumors: 90 Y-NM600 + ICI, 225 Ac-NM600 + ICI, EBRT + ICI, ICI. Linear mixed models were used to compare tumor volumes over time between various treatment groups. Statistical testing of the pairwise contrasts was adjusted for multiple comparisons using Tukey’s method. Log-rank test was used to compare survival. One-way ANOVA with Tukey’s HSD post hoc test was used to compare CD20 IHC quantification between treatment groups. Error bars are SEM. E Created in BioRender. Jin, W. (2026) https://BioRender.com/22ha1p4 .

Article Snippet: The murine colorectal carcinoma MC38 cell line, isolated from a female C57BL/6 mouse, was obtained from Millipore Sigma (Cat # SCC172), and the murine prostate cancer Myc-CaP cell line, isolated from a male FVB mouse, was obtained from American Type Culture Collection (ATCC) (Cat # CRL-3255).

Techniques: Single Cell, RNA Sequencing, Isolation, Gradient Centrifugation, Marker, Immunolabeling

(A–E) The mRNA transcripts of four types of coronavirus receptors such as membrane alanyl aminopeptidase (ANPEP, CD13, receptor for human coronavirus-229E), carcinoembryonic antigen family cell adhesion molecule 1 (CEACAM1, receptor for mouse hepatitis virus), angiotensin-converting enzyme 2 (ACE, receptor for SARS-CoV, SARS-CoV2), and dipeptidyl peptidase-4 (DPP4, receptor for MERS-CoV) as well as TMPRSS2 are found in two clusters of human heart endothelial cells. The data mining analyses were performed on the Single Cell RNA-Seq database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP498/transcriptional-and-cellular-diversity-of-the-human-heart#study-summary ). (F–J) The mRNA transcripts of four types of coronavirus receptors such as ANPEP, CEACAM1, ACE, and DPP4 are found in mouse aortic endothelial cell clusters. The data mining analyses were performed on the Single Cell RNA-Seq database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP289/single-cell-analysis-of-the-normal-mouse-aorta-reveals-functionally-distinct-endothelial-cell-populations#study-summay , PMID: 31146585). (F) ANPEP expressions in three endothelial cell clusters were circled in red in the Scatter; (G) ANPEP expressions in three endothelial cell clusters were boxed in red in the Distribution; (H) CEACAM1 expressions in three endothelial cell clusters were also boxed in read in the Distribution; (I) ACE expressions in three endothelial cell clusters were also boxed in read in the Distribution; (J) DPP4 expressions in three endothelial cell clusters were also boxed in read in the Distribution. (K) A new working model: Infection of vascular endothelial cells by SARS-CoV2/MERS-CoV causes innate immune responses in endothelial cells, which may induces cytokine storm, and triggers thromboembolism. The part of figure was created with BioRender.com .

Journal: Frontiers in Immunology

Article Title: Endothelial Immunity Trained by Coronavirus Infections, DAMP Stimulations and Regulated by Anti-Oxidant NRF2 May Contribute to Inflammations, Myelopoiesis, COVID-19 Cytokine Storms and Thromboembolism

doi: 10.3389/fimmu.2021.653110

Figure Lengend Snippet: (A–E) The mRNA transcripts of four types of coronavirus receptors such as membrane alanyl aminopeptidase (ANPEP, CD13, receptor for human coronavirus-229E), carcinoembryonic antigen family cell adhesion molecule 1 (CEACAM1, receptor for mouse hepatitis virus), angiotensin-converting enzyme 2 (ACE, receptor for SARS-CoV, SARS-CoV2), and dipeptidyl peptidase-4 (DPP4, receptor for MERS-CoV) as well as TMPRSS2 are found in two clusters of human heart endothelial cells. The data mining analyses were performed on the Single Cell RNA-Seq database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP498/transcriptional-and-cellular-diversity-of-the-human-heart#study-summary ). (F–J) The mRNA transcripts of four types of coronavirus receptors such as ANPEP, CEACAM1, ACE, and DPP4 are found in mouse aortic endothelial cell clusters. The data mining analyses were performed on the Single Cell RNA-Seq database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP289/single-cell-analysis-of-the-normal-mouse-aorta-reveals-functionally-distinct-endothelial-cell-populations#study-summay , PMID: 31146585). (F) ANPEP expressions in three endothelial cell clusters were circled in red in the Scatter; (G) ANPEP expressions in three endothelial cell clusters were boxed in red in the Distribution; (H) CEACAM1 expressions in three endothelial cell clusters were also boxed in read in the Distribution; (I) ACE expressions in three endothelial cell clusters were also boxed in read in the Distribution; (J) DPP4 expressions in three endothelial cell clusters were also boxed in read in the Distribution. (K) A new working model: Infection of vascular endothelial cells by SARS-CoV2/MERS-CoV causes innate immune responses in endothelial cells, which may induces cytokine storm, and triggers thromboembolism. The part of figure was created with BioRender.com .

Article Snippet: In addition, as shown in , all the four types of coronavirus receptors were also expressed in three EC clusters in mouse aorta in another single-cell RNA-Seq dataset, Study: Single-cell analysis of the normal mouse aorta reveals functionally distinct EC populations ( https://singlecell.broadinstitute.org/single_cell/study/SCP289 ) ( ).

Techniques: Membrane, Virus, RNA Sequencing, Single-cell Analysis, Infection